Pemanfaatan media lampion mekubi untuk meningkatkan kemampuan mengenal wanra anak kelompok A TK Pembina Kota Batu / Yogi Triyastuti

 

Penerapan metode pembelajaran kooperatif model numbered heads together untuk meningkatkan hasil belajar siswa pada mata pelajaran bekerja sama dengan kolega dan pelanggan (studi pada siswa kelas X Program Keahlian APK di SMK Ardjuna 01 Malang) / Reny Solviana

 

Kata kunci: pembelajaran kooperatif, model Numbered Heads Together, hasil belajar, PTK. Pendidikan mempunyai peran penting untuk meningkatkan kualitas hidup bangsa dan Negara dengan memciptakan kehidupan yang cerdas, terbuka, dan demokratis. Hal ini didasarkan pendidikan dijadikan sebagai salah satu tolak ukur kesejahteraan manusia. Salah satu penyempurnaan kurikulum yang dilakukan oleh pemerintah yaitu kurikulum 2004 atau kurikulum berbasis kompetensi (KBK) menjadi kurikulum tingkat satuan pendidikan atau lebih dikenal dengan KTSP. KTSP yang merupakan penyempurnaan dari kurikulum 2004 (KBK) adalah kurikulum opdrasional yang disusun dan dilaksanakan oleh masing-masing satuan pendidikan. Untuk dapat meningkatkan hasil belajar siswa khususnya pada mata pelajaran Bekerjasama Dengan Kolega Dan Pelangggan yaitu dengan menggunakan metode pembelajaran kooperatif model Numbered Heads Together, yang dalam penerapannya membantu siswa untuk memahami materi dan memberikan kesempatan kepada siswa utuk memberikan ide atau pendapat selain itu untuk meningkatkan kerjasama kelompok. Penelitian ini bertujuan untuk: 1) Untuk mengetahui penerapan model pembelajaran Numbered Heads Together untuk mengetahui hasil belajar siswa pada mata pelajaran Bekerjasama Dengan Kolega Dan Pelanggan, 2) Mengetahui hasil belajar setelah diterapkan metode pembelajaran kooperatif model NHT pada mata diklat Bekerjasama Dengan Kolega Dan Pelanggan, 3) Mendeskripsikan respon siswa dalam metode pembelajaran kooperatif NHT untuk meningkatkan hasil belajar siswa pada mata diklat Bekerjasama Dengan Kolega Dan Pelanggan. Pendekatan yang digunakan dalam penelitian ini adalah kualitatif dengan jenis penelitian tindakan kelas (PTK), yang terdiri dua siklus. Setiap siklus mencapai empat tahapan yaitu perencanaan tindakan, pelaksanaan tindakan, observasi, dan refleksi. Mata pelajaran yang digunakan dlam penelitian ini adalah Bekerjasama Dengan Kolega Dan pelanggan. Penelitian dilaksanakan di SMK Ardjuna 01 Malang. Subyek penelitian adalah siswa kelas X APk 1yang berjumlah 28 siswa. Data penelitian ini dikumpulkan melalui: 1) Observasi, 2) wawancara, 3) tes, 4) Catatan Lapangan, 5) Angket, 6) dokumentasi. Hasil penelitian menunjukkan bahwa metode pembejaran kooperatif model Numbered Heads Together dapat dilaksanakan dengan baik dengan respon siswa terhadap pembelajaran ini juga sangat kuat. Hasil belajar siswa pada mata pelajaran bekerjasama dengan kolega dan pelanggan setelah diterapakan metode pembejaran kooperatif model Numbered Heads Together mengalami peningkatan, penilaian tersebut dapat dilihat dari dua aspek yaitu aspek kognitif dan aspek afektif. Data hasil belajar siswa menunjukkan adanya peningkatan untuk aspek kognitif dan aspek afektif. Untuk aspek kognitif nilai rata-rata pre test yaitu 58,21. pada siklus I, sedangkan pada nilai rata-rata post test menjadi 81,42 pada siklus II. Untuk ketuntasan belajar secara klasikal aspek kogintif 14,29% pada siklus I menjadi 82,15% pada siklus II. Nilai rata-rata afektif mengalami peningkatan pada siklus I 71,78 dan 92,64 pada siklus II dan ketuntasan belajar secara klasikal pada aspk afektif 64,28% pada siklus I meningkat menjadi 96,42% pada siklus II. Beberapa saran yang dapat peneliti sampaikan yaitu 1) Guru hendaknya dapat menciptakan suasana yang kondusif dan menyenangkan karena dapat menumbuhkan keaktifan siswa pada proses belajar mengajar. 2) Metode pembelajaran kooperatif model Numbered Heads Together dapat dipilih sebagai alternatif strategi yang dapat diterapkan oleh guru-guru mata diklat yang lain. 3) bagi guru yang akan menerapkan metode pembelajaran Numbered Heads Together harus memperhatikan langkah-langkah pembelajaran dan menentukan waktu yang dibutuhkan. 4) dalam pelaksanaan pembelajaran sangat dibutuhkan informasi yang luas untuk menambah pengetahuan siswa, maka guru diharapkan menambah literatur buku serta mencari materi yang akan diajarkan dengan fasilitas internet.

Penerapan pembelajaran siklus belajar berbantuan media animasi komputer untuk meningkatkan keterampilan kerja ilmiah dan hasil belajar IPA siswa kelas VIII-H SMP Negeri 4 Kepanjen Kabupaten Malang / Heru Nurgiyanto

 

Kata kunci: animasi komputer, hasil belajar, kerja ilmiah, siklus belajar. Proses pembelajaran fisika di SMP Negeri 4 Kepanjen Kabupaten Malang sebenarnya sudah cukup baik, hanya saja aplikasi pembelajaran yang me¬nga¬rah¬kan pada meningkatkan keterampilan kerja ilmiah masih belum dapat dikembang¬kan. Hasil diskusi dengan guru mata pelajaran dan pengamatan proses pem¬be¬lajaran IPA (fisika) di kelas VIII-H, ditemukan per¬ma¬sa¬lah¬an rendahnya keteram¬pilan kerja ilmiah siswa dan hasil belajar siswa. Siswa yang tuntas belajar pada kelas tersebut belum mencapai 85%, se¬hing¬ga ke¬las dinyatakan belum mencapai kriteria ketuntasan minimal. Untuk mengatasi masalah dalam kegiatan pembelajaran di kelas tersebut, perlu adanya perbaikan model pembelajaran. Salah satu model pembe¬lajaran yang dianggap sesuai untuk menyelesaikan per¬masalahan tersebut adalah Pembelajaran Siklus Belajar Berbantuan Media Animasi Komputer. Siklus belajar menyajikan pembelajaran melalui suatu rangkaian kerja ilmiah, nilai dan sikap ilmiah. Media animasi komputer membantu memperjelas peristiwa yang terjadi sangat cepat atau sangat lambat. Penelitian ini merupakan penelitian tindakan kelas (PTK) yang dilak¬sa¬na-kan dalam dua siklus, dan masing-masing siklus terdiri dari tiga kali pertemuan. Pe¬¬ngumpulan data dilaksanakan pada bulan Juli sampai September 2010. Subjek yang diteliti adalah siswa kelas VIII-H SMP Negeri 4 Kepanjen, Kabupaten Ma-lang yang berjumlah 25 siswa terdiri dari 11 siswa laki-laki dan 14 siswa perem¬pu-an. Pengumpulan data dilakukan dengan cara observasi menggunakan lembar observasi yang dilakukan oleh observer dan tes tertulis. Data diana¬li¬sis dengan menggunakan model alur. Hasil penelitian menunjukkan bahwa Penerapan Pembelajaran Siklus Be¬la-jar Berbantuan Media Animasi Komputer dapat meningkatkan keterampilan kerja il¬mi¬ah dan hasil belajar IPA pokok bahasan Cahaya siswa di kelas VIII-H SMP Negeri 4 Kepanjen, Kabu¬pa¬ten Malang. Persentase ke¬ter¬¬capaian keteram¬pilan kerja ilmiah siswa sebe¬sar 72,18% pada siklus I meningkat menjadi 86,52% pada siklus II. Nilai rata-rata kelas pada siklus I sebesar 75,00 meningkat menjadi 79,56 pada siklus II. Ke¬tun¬¬ta¬san klasikal hasil bela¬jar kognitif meningkat dari siklus I ke siklus II dari 76% menjadi 88%. Hasil belajar psikomotorik meningkat dari 82,60% menjadi 88,43%. Guru mata pelajaran disarankan untuk menerapkan pembelajaran siklus belajar berbantuan media animasi komputer pada pokok bahasan dengan karakteristik yang sesuai misalnya kalor dan listrik dan dilakukan dengan tahapan yang sesuai. Peneliti lain juga disarankan untuk melakukan penelitian tentang keefektifan siklus belajar berbantuan media animasi komputer untuk mening¬katkan hasil belajar kognitif siswa.

Pembelajaran tata bahasa bahasa Indonesia bagi mahasiswa asing tingkat pemula pada Program Bunga 2010 ISP MCE (sebuah kajian deskriptif pembelajaran BIPA) / Choirul As'ari

 

Kata Kunci: Pembelajaran, Tata Bahasa Pembelajaran Tata Bahasa Indonesia bagi mahasiswa asing tingkat pemula di program Bunga 2010 merupakan program pembelajaran Bahasa Indonesia bagi mahasiswa asing asal Jepang yang dilaksanakan selama 13 hari yang diselenggarakan oleh Indonesia Studies Program STIE Malang Kucecwara. Penelitian ini bertujuan untuk mengetahui materi apa saja yang disajikan dalam program Bunga 2010 dan strategi apa yang digunakan dalam proses pembelajaran dengan metode deskriptif. Pendekatan penelitian yang digunakan adalah kualitatif dan dirancang dalam bentuk kualitatif deskripstif. Metode penggalian data yang digunakan adalah teknik wawancara, pengamatan dan studi dokumentasi. Teknik analisa yang digunakan adalah reduksi data, display data dan penarikan kesimpulan. Hasil yang diperoleh dalam penelitian ini, materi pembelajaran yang digunakan adalah meliputi kata tanya, kata ganti, kalimat penolakan dan persetujuan, angka, jam, kata sambung, kata depan, kata penghubung “yang”, imbuhan “me”, kalimat aktif dan pasif, kalimat perbandingan, imbuhan “ber”, “ber-an”, “me”, “me-i” serta “me-kan”. Strategi pembelajaran yang diteliti meliputi pengajar, bahan ajar, metode dan teknik, media dan evaluasi hasil pembelajaran. Ditemukan bahwa para pembelajaran dilakukan dengan sepenuhnya mengacu pada materi yang ada dan disajikan dengan metode pelatihan dan penjelasan. Media pembelajaran yang digunakan seperti ular tangga, catur jantra dan running text. Evaluasi diadakan setiap akhir kegiatan pembelajaran dan secara umum pada tengah dan akhir masa program. Dari hasil penelitian ini, saran-saran yang diajukan yaitu: (1) Bagi ISP MCE dalam rangka meningkatkan kualitas penyelenggaraan program perlu melakukan penambahan waktu pembelajaran untuk materi imbuhan “me-i” dan ”me-kan”, penggunaan metode pembelajaran yang lebih variatif dalam pembelajaran, dan perlu adanya kurikulum dan garis besar pembelajaran sebagai panduan bagi para pengajar. (2) Bagi Minor BIPA UM hendaknya melakukan pendampingan penyelenggaraan program kepada ISP MCE dan (3) Bagi peneliti lain untuk dapat mengembangkan penelitian ini dengan metode serta fokus penelitian yang lain, sehingga dapat secara berkelanjutan berpartisipasi aktif dalam pelaksanaan pengembangan kegiatan pembelajaran BIPA.

Analisis potensi dan prospek pembelajaran IPS terpadu pada kelas VIII dan IX di SMP Terbuka Kota Madiun / Kus Irawan Prabowo

 

Kata Kunci: Proses belajar mengajar, interaksi siswa, dan sumber belajar. Kota Madiun mendirikan SMP Terbuka untuk memberikan kesempatan pendidikan kepada masyarakat yang tidak dapat menyekolahkan anaknya dikarenakan faktor ekonomi dan geografis.Fokus penelitian ini adalah proses belajar mengajar, interaksi siswa, sumber belajar siswa dan hasil belajar siswa dalam pembelajaran IPS Terpadu di SMP Terbuka Kota Madiun. Penelitian ini menggunakan pendekatan fenomenologi. Jenis data yang digunakan dalam penelitian ini adalah data hasil rekaman wawancara, observasi dan dokumen yang diberikan oleh SMP Terbuka Kota Madiun. Teknik analisis dilakukan dengan teknik analisis deduktif induktif. Hasil penelitian ini menerangkan bahwa dalam proses belajar mengajar pelajaran IPS terpadu di SMP Terbuka Kota Madiun menggunakan metode TGT(Team Game Tournament) karena siswa menjadi lebih berkonsentrasi dan termotivasi, media dalam pembelajaran kelas IX menggunakan powerpoint sedangkan kelas VIII masih menggunakan lembar kerja siswa, kondisi siswa dalam kelas tergolong baik untuk kelas IX dan kelas VIII, peran guru adalah sebagai pemateri, pengawas dan pengevaluasi. Interaksi siswa dengan guru sangat baik karena siswa berani bertanya mengenai kesulitannya dalam materi, berani menjawab pertanyaan yang diberikan guru, dan di luar kelas siswa juga berinteraksi dengan guru. Interaksi siswa dengan siswa tergolong baik karena siswa sering berinteraksi dengan siswa yang lain mengenai materi dalam pembelajaran, tetapi siswa hanya memilih jenis kelamin yang sama dalam interaksi di dalam kelas. Dalam pemanfaatan sumber belajar, siswa menggunakan sumber belajar yang disediakan oleh SMP induk baik perpustakaan, laboratorium, buku-buku untuk menulis. Dalam kehidupan sehari-hari siswa sering belajar mengenai ekonomi dari kegiatan yang dilakukannya saat membeli barang diwarung, counter, dealer, dsb. Nilai hasil belajar pada pembelajaran IPS Terpadu sangat bervariasi ada yang tinggi dan rendah, untuk memperoleh nilai pelajaran IPS Terpadu tersebut bermacam-macam cara yang dilakukan siswa. Proses belajar mengajarnya, interaksi siswa, pemanfaatan sumber belajar dan nilai hasil belajar IPS Terpadu pada kelas VIII dan IX di SMP Terbuka Kota Madiun maka pembelajaran IPS Terpadu pada SMP Terbuka Kota Madiun memiliki potensi dan prospek yang sangat besar tinggal melakukan beberapa kegiatan yang ada di modul sehingga harapannya potensi ini akan lebih baik lagi dan memberikan kemajuan pada SMP Terbuka. Saran untuk pengelola SMP Terbuka Kota Madiun melakukan beberapa perbaikan-perbaikan dalam seleksi penerimaan siswa, jam tatap muka dan peraturan tatap muka.

Pengaruh model pembelajaran kreatif-produktif terhadap prestasi belajar ditinjau dari kemampuan berpikir kritis siswa kelas X Program RSBI di SMAN 1 Blitar / Mohamad Norkotib

 

Keywords: Model Pembelajaran, Model Kreatif Produktif, Prestasi Belajar Penelitian ini bertujuan untuk mengetahui dan menganalisis, 1) Apakah terdapat perbedaan prestasi belajar antara siswa yang belajar dengan Model Pembelajaran Kreatif-Produktif (MPKP) dan siswa yang belajar dengan model konvensional; 2) Apakah terdapat interaksi antara model pembelajaran dan kemampuan berpikir kritis terhadap prestasi belajar siswa; 3) bagi siswa yang memiliki kemampuan berpikir kritis tinggi apakah terdapat perbedaan prestasi belajar, jika belajar dengan model pembelajaran kreatif-produktif dan belajar dengan cara konvensional; 4) bagi siswa yang memiliki kemampuan berpikir kritis rendah apakah terdapat perbedaan prestasi belajar, jika belajar dengan model pembelajaran kreatif-produktif dan belajar dengan cara konvensional. Penelitian ini menggunakan rancangan eksperimen deskriptif-kuantitaif untuk menjawab pertanyaan di atas. Instrumen penelitian ini adalah tes prestasi belajar (20 butir soal pilihan ganda) dan tes kemampuan berpikir kritis (15 butir soal pilihan ganda). Data penelitian berupa nilai tes prestasi belajar dan nilai tes kemampuan berpikir kritis yang diperoleh siswa kelas konvensional maupun kelas kreatif-produktif. data dianalisis menggunakan analisis varian dua jalur. Hasil analisis data menunjukkan bahwa prestasi belajar yang ditinjau dari kemampuan berpikir kritis siswa kelas X program RSBI di SMAN 1 Blitar dipengaruhi oleh model pembelajaran kreatif-produktif dan kemampuan berpikir kritis. model pembelajaran kreatif-produktif memberikan pengaruh terhadap prestasi belajar lebih baik daripada model konvensional. temuan lain penelitian ini menunjukkan bahwa model pembelajaran kreatif-produktif memotivasi siswa aktif belajar, melatih siswa belajar mandiri dan menumbuhkan kreativitas siswa.

Kajian/studi tentang gerak melingkar secara sederhana / Ludia Orpa Ngoyem

 

Kata kunci :Kajian/Studi, gerak melingkar. Berdasarkan observasi peneliti, masih banyak siswa yang merasa fisika adalah ilmu pengetahuan yang sulit. Agar fisika dipandang oleh siswa sebagai ilmu ilmu pengetahuan yang menyenangkan pada tulisan ini disajiakan kajian tentang’’gerak melingkar secara sederhana’’, Metode yang yang digunakan dalam penelitian ini adalah deskripsi sederhana.

Penelaahan terhadap usaha peningkatan pengajaran praktek pembukuan di SMEP Negeri Nganjuk / oleh Sukarsih

 

Pengaruh CAR (Capital Adequacy Ratio), NPL (Non Performing Loan), LDR (Loan to Deposit Ratio) terhadap return melalui ROE (Return on Equity) pada perusahaan perbankan tahun 2009 / Fitria Arisukma

 

Kata kunci: Return, CAR (Capital Adequacy Ratio), NPL (Non Performing Loan), LDR (Loan To Deposit Ratio), ROE (Return On Equity) Return adalah tingkat kembalian yang dinikmati oleh pemodal atas suatu investasi yang dilakukannya. Konsep return yang digunakan adalah capital gain, yaitu keuntungan yang diterima karena adanya selisih antara harga jual dengan harga beli saham dari suatu instrumen investasi. Setiap investasi baik jangka pendek maupun jangka panjang mempunyai tujuan utama mendapatkan keuntungan yang disebut sebagai return baik langsung maupun tidak langsung. Indikator untuk mengukur return diantaranya adalah CAR (Capital Adequacy Ratio) merupakan rasio yang memperlihatkan seberapa besar jumlah seluruh aktiva bank yang mengandung risiko ikut dibiayai modal sendiri, NPL (Non Performing Loan) merupakan rasio yang mengukur kredit tidak lancar dimana tingkat pengembalian kredit yang diberikan deposan kepada bank mengalami kesulitan pelunasan, LDR (Loan To Deposit Ratio) merupakan rasio yang mengukur seberapa jauh kemampuan bank dalam membayar semua dana masyarakat serta modal sendiri dengan mengandalkan kredit yang telah didistribusikan ke masyarakat, ROE (Return On Equity) merupakan rasio yang mengukur kemampuan perusahaan dalam menghasilkan laba bersih berdasarkan modal tertentu. Tujuan penelitian ini adalah untuk menguji pengaruh CAR (Capital Adequacy Ratio), NPL (Non Performing Loan), LDR (Loan To Deposit Ratio) secara langsung terhadap Return dan pengaruh tidak langsung melalui ROE (Return On Equity) pada perusahaan perbankan tahun 2009 baik secara parsial maupun simultan. Populasi yang digunakan dalam penelitian ini adalah seluruh perusahaan perbankan di Indonesia, namun setelah digunakan teknik purposive sampling didapatkan sampel sebanyak 30 perusahaan, dengan periode pengamatan tahun 2009. Teknik analisis data yang digunakan dalam penelitian ini adalah path analysis dengan menggunakan program SPSS 16. Hasil penelitian ini menunjukkan bahwa CAR berpengaruh negatif terhadap ROE, dan tidak berpengaruh terhadap return, ROE berpengaruh positif terhadap return, sehingga ROE merupakan variabel mediasi antara variabel CAR terhadap return. NPL berpengaruh negatif terhadap ROE, dan NPL berpengaruh positif terhadap return, ROE berpengaruh positif terhadap return, sehingga ROE merupakan variabel moderator antara NPL terhadap return. LDR tidak berpengaruh terhadap ROE, LDR berpengaruh positif terhadap return, dan ROE berpengaruh terhadap return, sehingga ROE tidak berfungsi sebagai variabel moderator antara LDR terhadap return. Berdasarkan penelitian ini maka akan disarankan dalam penelitian lebih lanjut untuk menambah variabel bebas yang lain yang dapat diindikasikan berpengaruh terhadap return baik secara langsung maupun tidak langsung serta membedakan sampel perusahaan. Bagi investor penelitian ini dapat dijadikan gambaran untuk mengambil keputusan yang tepat sebelum berinvestasi.

Pengaruh pembelajaran kontekstual berbasis ICT dengan strategi inkuiri pada materi virus dan monera terhadap motivasi dan hasil belajar siswa kelas X SMA Negeri 1 Bangil Pasuruan / Abdul Basith

 

Kata kunci: pembelajaran kontekstual, ICT, strategi inkuiri, motivasi, hasil belajar Perkembangan ilmu pengetahuan dan teknologi sangat pesat pada abad 21 ini mengakibatkan perubahan peran guru yang semula sebagai sumber informasi ilmu pengetahuan dalam proses pembelajaran, menjadi fasilitator, pembimbing, konsultan dan kawan belajar. Pembelajaran diarahkan pada pembelajaran langsung oleh siswa, waktu belajar lebih fleksibel dan mengutamakan kolaborasi. Kenyataan yang dihadapi oleh dunia pendidikan dewasa ini di Indonesia adalah adanya krisis paradigma berupa kesenjangan antara tujuan yang ingin dicapai dengan paradigma yang digunakan. Salah satu standar kompetensi mata pelajaran Biologi SMA kelas X dalam kurikulum 2004 adalah siswa memahami prinsip-prinsip pengelompokkan mahluk hidup. Indikator-indikator yang diharapkan yaitu siswa mendiskripsikan ciri-ciri dan struktur Virus dan Monera melalui pengamatan langsung di bawah mikroskop dan referensi, mengidentifikasi macam-macam koloni, mengklasifikasi kan, membedakan dan menganalisa sifat Virus, Eubachteria, Archaebachteria dan Cyanobacteri, menggali berbagai informasi melalui penugasan, mendiskusikan berbagai peranan dan penyakit yang terjadi dalam kehidupan manusia. Untuk mencapai harapan tersebut perlu pemanfaatan sumber belajar dan teknologi ICT dengan menyediakan objek nyata dan memberikan pengalaman belajar yang kontekstual. Namun fakta di lapangan menunjukkan masih rendahnya kesadaran, adanya kendala dan kurangnya kreatifitas guru, sehingga kompetensi yang di harapkan pada siswa kurang tercapai secara optimal. Oleh sebab itu, untuk mem perkecil kesenjangan dan menumbuhkan kreatifitas sehubungan dengan pencapaian kompetensi yang diharapkan pada siswa, maka alternatif yang dapat ditempuh salah satunya adalah pembelajaran strategi inkuiri dan pemanfaatan teknologi komputer yaitu internet yang tersedia di sekolah. Penelitian ini bertujuan untuk mengetahui pengaruh pembelajaran kontekstual berbasis ICTdengan strategi inkuiri terhadap hasil belajar siswa dan motivasi belajar siswa. Jenis penelitian yang digunakan adalah quasi eksperimen dengan rancangan pretes dan postes kelompok tak setara atau faktorial 2x2 (the non-equivalent control group design). Subjek penelitian adalah siswa kelas X SMA Negeri 1 Bangil Pasuruan tahun pelajaran 2010-2011 berjumlah 48 siswa dengan strategi inkuiri pembelajaran kontekstual berbasis ICT. Pengambilan sampel dan penentuan perlakuan setiap kelompok dilakukan penunjukan berdasarkan prestasi jumlah nilai NUN SMP melalui data rekapitulasi jumlah nilai NUN SMP pada PSB SMAN 1 Bangil tahun pelajaran 2010-2011. Analisis data hasil belajar siswa dan motivasi belajar siswa menggunakan teknik analisis unvariat (Anakova) dan dilanjutkan dengan uji lanjut LSD dengan bantuan program SPSS versi 17.0 Hasil penelitian menunjukkan bahwa dengan menggunakan ICT dengan strategi inkuiri pada pembelajaran kontekstual memberikan pengaruh yang signifikan terhadap proses pembelajaran dan hasil belajar biologi siswa pada materi virus dan monera. Pemanfaatan ICT dengan strategi inkuiri lebih berpengaruh dibandingkan dengan pembelajaran konvensional terhadap motivasi belajar dan hasil belajar kognitif, afektif dan psikomotor siswa khususnya materi virus-monera. Sebagian besar siswa menunjukkan perhatian yang sangat tinggi, merasakan adanya keterkaitan, percaya diri dan kepuasan yang positif terhadap penggunaan sumber media ICT dengan strategi inkuiri. Dalam pembelajaran ini tidak hanya mengutamakan kemampuan kognitif siswa, tetapi mengkolaborasikan kemampuan afektif dan psikomotor. Berdasarkan hasil penelitian dapat diajukan beberapa saran yaitu; (1) untuk meningkatkan kompetensi siswa dalam kemampuan mengidentifikasi, mem bedakan, menjelaskan dasar-dasar pengelompokan, (2) meningkatkan kompetensi siswa dalam kemampuan melakukan pengkajian tentang perkembangbiakan virus-monera, peranan yang menguntungkan dan merugikan bagi kehidupan manusia, (3) mendapatkan gambaran yang lengkap dan utuh tentang pembelajaran kontekstual berbasis ICT dengan strategi inkuiri terhadap motivasi dan hasil belajar siswa khususnya materi virus-monera, maka dipandang perlu bagi peneliti lain untuk memperluas dan mengembangkan variabel penelitian Dari hasil analisis data dan hasil pembahasan dapat dibuat kesimpulan bahwa terdapat perbedaan yang signifikan antara pembelajaran kontekstual berbasis ICT dengan strategi inkuiri terhadap motivasi,hasil belajar kognitif, afektif dan psikomotor dengan pembelajaran konvensional.

Perbandingan regresi komponen utama dengan regresi Gulud untuk mengetahui faktor-faktor yang mempengaruhi kepuasan nasabah / Dini Sukmaningsih

 

Kata kunci: Regresi Komponen Utama, Regresi Gulud, Kepuasan Nasabah Kepuasan nasabah adalah keadaan psikis yang menyenangkan yang dirasakan oleh nasabah di suatu lingkungan karena terpenuhinya kebutuhan secara memadai. Faktor-faktor yang mempengaruhi kepuasan nasabah atas pelayanan yang diterima meliputi : bunga yang diberikan, fasilitas yang menunjang proses transaksi, pelayanan yang diterima, jaminan keamanan dan lingkungan yang menunjang prioritas transaksi. Faktor-faktor yang mempengaruhi kepuasan nasabah pada penelitian ini ditentukan dengan analisis regresi komponen utama dan regresi gulud. Regresi komponen utama merupakan teknik analisis regresi yang dikombinasikan dengan teknik analisis komponen utama yaitu menjadikan analisis komponen utama sebagai tahap analisis untuk mendapatkan hasil akhir dalam analisis regresi. Regresi gulud merupakan salah satu metode yang dianjurkan untuk mengatasi masalah multikolinieritas dengan cara memodifikasi metode kuadrat terkecil biasa (MKTB). Modifikasi tersebut dilakukan dengan cara menambah tetapan bias, θyang relatif kecil pada matriks diagonal X’X, sehingga penduga koefisien regresi dipengaruhi oleh besarnya tetapan bias. Tujuan dari penelitian ini adalah untuk mengetahui model terbaik regresi komponen utama dan regresi gulud dari kepuasan nasabah terhadap faktor bunga, fasilitas, pelayanan, keamanan, dan lingkungan, kemudian membandingkan model terbaik regresi komponen utama dan regresi gulud. Dari hasil penelitian diperoleh model Regresi Komponen Utama sebagai berikut: Y = 15.3 + 0.4791 X1 + 0.4999 X2 + 0.4791 X3 + 0.4910 X4 + 0.1620X5 dengan R-sq = 66,5 %, KTG = 2.016, dan F-hitung = 35,68 Sedangkan untuk model Regresi Gulud sebagai berikut : Y = 15.3 + 0.3217 X1 + 0.3448 X2 + 0.3965 X3 + 0.3854 X4 + 0.1410 X5 Dengan R2 = 65.13%, KTG = 2.694, dan F-hitung = 5.23. Dari perbandingan kedua metode tersebut diperoleh nilai kuadrat tengah galat (KTG) model regresi komponen utama lebih kecil dari regresi gulud, sedangkan nilai R-sq dan F-hitung model Regresi Komponen Utama lebih besar dari Regresi Gulud sehingga dapat dikatakan bahwa model Regresi Komponen Utama lebih baik untuk mengetahui faktor-faktor yang mempengaruhi kepuasan nasabah di Bank Rakyat Indonesia cabang Kediri.

Pengaruh kualitas produk terhadap keputusan pembelian konsumen (studi pada warga Perumnas Sawojajar pelanggan koran Jawa Pos Radar Malang) / Arifin

 

Kata kunci: kualitas produk, keputusan pembelian (pelanggan). Dalam era globalisasi, persaingan di dunia bisnis semakin ketat. Munculnya para pemain baru dalam industri dan bisnis sejenis menyebabkan berkurangnya pangsa pasar yang telah dikuasai. Bahkan bukan tidak mungkin akan mengeser posisi perusahaan dalam waktu singkat akibat munculnya pesaing baru yang lebih agresif. Seperti halnya dalam bidang penerbitan media cetak munculnya banyak media cetak baru dengan keunggulan-keunggulan tertentu tentunya akan mempengaruhi perilaku pembelian konsumen dan berpotensi untuk merebut pelanggan media cetak lain. Demikian halnya dengan Jawa Pos-Radar Malang merupakan perusahaan penerbit surat kabar/Koran terkemuka di Jawa Timur, juga harus mencermati selera pasar, mengingat sebagian besar masyarakat masih menjadikan koran sebagai alternatif untuk mendapatkan informasi terkini sehari-hari. Maka dari itu Jawa Pos-Radar Malang melakukan strategi agar pelanggan yang sudah ada berubah menjadi konsumen yang loyal dan menarik minat konsumen baru dengan memberikan keunggulan dalam kualitas produk yang melekat pada koran Jawa Pos-Radar Malang yang diberlakukan untuk periode waktu tertentu dan akan berubah sesuai kondisi persaingan yang sudah ada. Maka penulis tertarik untuk mengambil judul “Pengaruh Kualitas Produk terhadap Keputusan Pembelian Konsumen dalam membeli koran (Studi pada Warga Perumnas Sawojajar Pelanggan koran Jawa Pos-Radar Malang)”. Penelitian ini bertujuan untuk mengetahui (1) kondisi kualitas produk dan keputusan pembelian konsumen pelanggan Perumnas Sawojajar dalam membeli produk koran Jawa Pos-Radar Malang. (2) pengaruh kualitas produk yang terdiri dari kinerja produk (performance), keistimewaan produk (features), keandalan produk (reliability), kemampulayanan produk (service ability), dan persepsi kualitas produk (perceived quality) secara parsial terhadap keputusan pembelian koran Jawa Pos-Radar Malang di Perumnas Sawojajar. (3) pengaruh kualitas produk yang terdiri dari kinerja produk (performance), keistimewaan produk (features), keandalan produk (reliability), kemampulayanan produk (service eability), dan persepsi kualitas produk (perceived quality) secara simultan terhadap keputusan pembelian koran Jawa Pos-Radar Malang di Perumnas Sawojajar. (4) dimensi kualitas produk tersebut di atas, manakah yang paling berpengaruh terhadap keputusan pembelian konsumen Perumnas Sawojajar dalam membeli produk koran Jawa Pos-Radar Malang Penelitian ini menggunakan instrument berupa kuesioner yang kemudian hasilnya dianalisis melalui analisis regresi linier berganda. Populasi dalam penelitian ini adalah pelanggan tetap koran Jawa Pos-Radar Malang yang berlangganan pada agen Jawa Pos di Perumnas Sawojajar. Teknik pengambilan sampel dalam penelitian ini menggunakan proportional random sampling jumlah populasi 2400 responden, sedangkan jumlah sample sebesar 100. Berdasarkan hasil analisis regresi diketahui bahwa terdapat pengaruh kualitas produk yang terdiri dari kinerja produk (performance), keistimewaan produk (featurers), keandalan produk (reliability), kemampulayanan produk (service ability), serta persepsi kualitas produk (perceived quality) secara parsial terhadap keputusan pembelian koran Jawa Pos-Radar Malang di Perumnas Sawojajar. Hal ini dibuktikan dengan pengaruh kinerja produk terhadap keputusan pembelian dengan nilai t hitung > t tabel yaitu 7,944 > 1, 6669 dengan taraf signifikansi t = 0.000 0,05; pengaruh keitimewaan produk terhadap keputusan pembelian dengan nilai t hitung > t tabel yaitu -2,614 > 1,6669 dan nilai signifikasi t = 0,010 0,05; pengaruh keandalan produk terhadap keputusan pembelian dengan nilai t hitung > t tabel yaitu -2,482 > 1,6669 dan nilai signifikansi t = 0,015 0,05; pengaruh kemampulayanan produk terhadap keputusan pembelian dengan nilai t hitung > t tabel yaitu 0,883 > 1,6669 dan nilai signifikansi t = 0,379 > 1,6669 dan nilai signifikansi t = 0,379 0,05; pengaruh persepsi kualitas produk terhadap keputusan pembelian dengan nilai t hitung > t tabel yaitu -1,183 > 1,6669 dan nilai signifikansi t = 0,240 0,05. Berdasarkan nilai Fhitung sebesar 14,016 dengan tingkat signifikansi 0,000 dapat disimpulkan terdapat pengaruh kualitas produk yang terdiri dari kinerja produk (performance), keistimewaan produk (features), keandalan produk (reliability), kamampulayanan produk (service ability), serta persepsi kualitas produk (perceived quality) secara simultan terhadap keputusan pembelian koran Jawa Pos-Radar Malang. Diketahui pula bahwa nilai Adjusted R Squarer sebesar 0,397 atau 39,7% dapat diartikan bahwa variabel kulitas produk dalam mempengaruhi keputusan pembelian koran Jawa Pos-Radar Malang adalah sebesar 39,7% dan sisanya sebesar 60,3% dipengaruhi hal-hal lain yang tidak dijelaskan dalam penelitian ini Berdasarkan temuan di atas, saran yang dapat diberikan peneliti bagi pihak Jawa Pos-Radar Malang hendaknya lebih memperhatikan unsur kinerja produk yang meliputi penyajian headline , keaktulitasan berita, keragaman berita, dan keakuratan berita. Dikarenakan kinerja produk merupakan unsur yang berpengaruh dominan terhadap keputusan pembelian koran Jawa Pos-Radar Malang. Maka dari itu, disarankan agar Jawa Pos-Radar Malang dapat selalu menjaga kualitas produk dan unsur-unsur yang terkandung didalamnya sehingga dapat mempertahankan dan meningkatkan minat pembeliaan dan kesetiaan. Disamping juga menambah porsi pemberitaan, mengurangi space iklan dan tidak menaikkan harga. Sedangkan bagi peneliti selanjutnya, hendaknya peneliti selanjutnya dapat menggali variabel-variabel baru selain kinerja produk, keistimewaan produk, keandalan produk, kemampulayanan produk, dan persepsi kualitas produk yang dapat mempengaruhi keputusan pembelian, yang diperkirakan meliputi variabel kualitas layanan, atribut produk, kepuasan, aspek psikologis dan beberapa variabel lain yang dapat dijadikan temuan baru dalam penelitian selanjutnya. Peneliti yang akan datang juga diharapkan lebih selektif dalam memilih teknik pengambilan sampel, agar sampel yang diperoleh lebih mewakili populasi secara keseluruhan.

Menggali pemahaman dan miskonsepsi siswa SMAN 2 Malang tentang laju reaksi dengan menggunakan instrumen duagnostik two-tier / Oscar Prananda P.

 

Pajaindo, Oscar Prananda. 2012. Menggali Pemahaman Siswa SMA pada Konsep Laju Reaksi dengan Menggunakan Instrumen Diagnostik Two-Tier. Skripsi, Jurusan Kimia FMIPA Universitas Negeri Malang. Pembimbing: (1) Drs. Prayitno, M.Pd., (2) Dr. Fauziatul Fajaroh, M.S. Kata kunci : miskonsepi, laju reaksi, tes diagnostik two–tier.    Ilmu kimia merupakan salah satu cabang ilmu pengetahuan yang memiliki karakteristik abstrak, berurutan dan berjenjang. Oleh karena itu, apabila siswa kurang memahami konsep dasarnya, maka siswa tersebut akan mengalami kesulitan dalam memahami konsep berikutnya. Jika kesulitan yang dialami siswa tidak segera diatasi dapat menimbulkan miskonsepsi. Miskonsepsi pada siswa sulit dihilangkan dan akan terbawa hingga jenjang pendidikan yang lebih tinggi. Hal ini menyebabkan siswa kesulitan dalam menghubungkan konsep baru dengan konsep salah yang dimilikinya. Laju Reaksi merupakan salah satu konsep dalam kimia yang sulit untuk dipahami. Salah satu cara yang digunakan untuk mengetahui pemahaman dan mengidentifikasi miskonsepsi siswa menggunakan instrumen diagnostik two–tier. Oleh karena itu, peneliti terdorong untuk melakukan penelitian penggunaan instrumen diagnostik two–tier dengan tujuan untuk menggali pemahaman dan mengidentifikasi miskonsepsi yang dimiliki siswa pada materi laju reaksi.     Penelitian yang dilakukan merupakan penelitian deskriptif. Subjek penelitian 94 siswa SMA kelas XI IPA. Instrumen yang digunakan adalah tes diagnostik two–tier berjumlah 25 butir soal dengan 2-4 alternatif jawaban disertai 3-5 alternatif alasan pilihan jawaban. Langkah-langkah penyusunan instrumen sebagai berikut: (1) menentukan cakupan konsep yang diteliti, (2) melakukan kajian literatur, (3) menyusun dan menyebarkan tes terbuka, (4) penyusunan dan validasi instrumen diagnostik two-tier. Reliabilitas instrumen sebesar 0,833. Data hasil tes dianalisis secara deskriptif, sedangkan miskonsepsi yang dialami siswa ditentukan berdasarkan kekonsistenan jawaban salah yang dialami siswa pada setiap pasangan soal.     Hasil penelitian tentang pemahaman dan kesalahan konsep siswa sebagai berikut. (a) Pemahaman siswa pada laju reaksi tergolong cukup, (b) ditemukan sebanyak 16 miskonsepsi antara lain: (1) laju reaksi ditentukan berdasarkan konsentrasi reaktan pada tahap cepat, (2) pada reaksi dengan harga energi aktifasi (Ea) tinggi akan lebih cepat, (3) tumbukan dengan orientasi tepat hanya terjadi pada atom-atom sejenis, (4) laju reaksi merupakan laju penambahan reaktan atau pengurangan produk, (5) pada reaksi orde nol laju reaksi semakin meningkat dengan berkurangnya konsentrasi reaktan, (6) katalis akan meningkatkan energi aktivasi sehingga reaksi akan berjalan lebih cepat, (7) pada massa yang sama laju reaksi akan semakin cepat dengan bertambahnya ukuran pereaksi, dan (8) laju reaksi makin cepat pada suhu rendah.

Pengaruh penggunaan wireless phone sebagai pengganti pemandu pada lari sprint 100 meter tunanetra terhadap waktu tempuh di UPT Rehabilitasi Sosial Cacat Netra (RSCN) Janti-Malang / Ericho Brian Wiratma

 

Kata Kunci: Tunanetra, lari sprint, wireless phone Lari sprint merupakan salah satu cabang olahraga atletik yang digemari dan menarik untuk ditonton. Lari sprint terbagi menjadi jarak 100 meter dan 200 meter. Lari sprint 100 meter juga dilakukan oleh tunanetra, yang berlari dengan peraturan khusus untuk penyandang cacat. Perbedaannya terletak pada tata cara berlari, dimana tunanetra berlari satu-persatu di lintasan. Tunanetra juga dibantu pemandu ketika berlari, yang dilakukan dengan beberapa metode untuk memandu. Sedangkan untuk tata cara start dan finish sama dengan lari sprint untuk pelari normal. Penelitian ini merupakan penelitian eksperimen semu, karena dilakukan tanpa adanya kelompok kontrol, dan dilakukan untuk mengetahui apakah penggunaan wireless phone memberikan pengaruh terhadap waktu tempuh pada lari sprint 100 meter tunanetra di UPT Rehabilitasi Sosial Cacat Netra (RSCN) Janti – Malang. Sampel penelitian ini berjumlah 10 orang tunanetra laki-laki. Tes lari dilakukan sebanyak dua kali untuk memperoleh data yang selanjutnya dianalisis dan digunakan untuk menarik kesimpulan. Tes awal dilakukan dengan tes lari sprint 100 meter tunanetra dengan pemandu, tes akhir dilakukan dengan tes lari sprint 100 meter tunanetra dengan menggunakan wireless phone dimana tunanetra sudah belajar bagaimana cara menggunakan wireless phone. Analisa data berupa uji normalitas kolmogorov smirnov (one sample kolmogorov smirnov), uji homogenitas (levene statistic) dan uji beda teknik wilcoxon (wilcoxon signed ranks test). Hasil penelitian menunjukan ada pengaruh penggunaan wireless phone terhadap waktu tempuh pada lari sprint 100 meter tunanetra, dari 10 sampel, 9 sampel mengalami perubahan positif dan 1 sampel mengalami perubahan negatif. Terjadi peningkatan rata-rata waktu tempuh (semakin cepat) dari 17.1105 detik menjadi 16.7340 detik. Kesimpulan dari penelitian ini adalah penggunaan wireless phone mempengaruhi waktu tempuh pada lari sprint 100 meter tunanetra di UPT RSCN Janti – malang. Penelitian ini sangat menarik untuk dilakukan, terlebih lagi apabila penelitian dilakukan tidak hanya pada tunanetra saja. Karena banyak penyandang cacat lainnya yang juga gemar berolahraga. Untuk penelitian-penelitian selanjutnya, diharapkan semakin banyak dilakukan penelitian pada olahraga penyandang cacat. Agar olahraga untuk penyandang cacat semakin dikenal oleh khalayak umum.

Pengaruh debt to equity ratio (DER) dan debt to total asset ratio (DAR) terhadap earning per share (EPS) melalui return on equity (ROE) pada perusahaan food and beverages yang listing di BEI tahun 2007-2009 / Hartatiek

 

Kata Kunci: Debt To Equity Ratio (DER), Debt To Total Assets Ratio (DAR), Return On Equity (ROE), dan Earning Per Share (EPS). Tujuan perusahaan secara umum yaitu mencapai tingkat laba yang optimal. Diukur dengan Return On Equity (ROE). Banyak variabel yang dapat digunakan untuk menentukan besarnya ROE, diantaranya yaitu Debt To Equity Ratio (DER) dan Debt To Total Assets Ratio (DAR). Kedua struktur modal ini dapat mempengaruhi ROE perusahaan. Semakin efisien penggunaan hutang maka ROE perusahaan juga semakin baik. Selain mencapai tingkat laba yang optimal, tugas lain perusahaan adalah memaksimalkan nilai perusahaan yang pada akhirnya berdampak pada tingkat pengembalian yang akan didapat dari aktivitas investasinya. Jika kondisi perusahaan dikategorikan menguntungkan atau menjanjikan keuntungan dimasa mendatang, maka banyak investor yang akan menanamkan dananya untuk membeli saham perusahaan tersebut. Penelitian ini bertujuan untuk mengetahui secara langsung pengaruh DER dan DAR terhadap EPS dan tidak langsung melalui ROE pada perusahaan Food and Beverage yang listing di BEI tahun 2007-2009. Variabel bebas dalam penelitian ini adalah DER, DAR dan ROE, sementara itu variabel terikat adalah EPS. Penelitian ini merupakan jenis penelitian asosiatif yang bersifat kausalitas, sampel dalam penelitian menggunakan teknik simple random sampling dan teknik analisis data menggunakan analisis jalur (path analysis). Hasil penelitian ini menunjukkan bahwa variabel Debt To Equity Ratio (DER) tidak berpengaruh langsung terhadap Earning Per Share (EPS) tetapi berpengaruh secara tidak langsung melalui Return On Equity (ROE). Dan Debt To Total Asset Ratio (DAR) juga tidak berpengaruh langsung terhadap Earning Per Share (EPS) tetapi berpengaruh secara tidak langsung melalui Return On Equity (ROE). Berdasarkan hasil tersebut, disarankan bagi para investor untuk melihat struktur modal yang dimiliki perusahaan karena struktur modal dapat mempengaruhi profitabilitas perusahaan. Sedangkan bagi manajemen perusahaan disarankan agar lebih memperhatikan kegiatan operasional perusahaan sehingga kinerja perusahaan dapat ditingkatkan. Serta untuk para peneliti selanjutnya disarankan untuk menambah variabel lain yang diduga berpotensi mempengaruhi EPS, seperti rasio perputaran aktiva tetap, penjualan, dan perputaran modal kerja. Periode pengamatan dan sampel ditambah atau bahkan meneliti pada sektor lain untuk memperoleh hasil yang berbeda.

Penerapan model pembelajaran kooperatif student teams achievement division (STAD) berbantuan komputer untuk meningkatkan motivasi dan hasil belajar IPA siswa kelas VII A SMP Negeri 1 Kesamben / Suep Hadisiswoyo

 

Kata Kunci: motivasi belajar, hasil belajar, pembelajaran kooperatif. Hasil pengamatan awal terhadap pelaksanaan pembelajaran IPA di SMP Negeri 1 Kesamben menunjukkan motivasi belajar dan hasil belajar IPA siswa masih rendah. Guru sering mengalami kesulitan dalam merangsang siswa agar berani mengemukakan pendapat dalam proses pembelajaran. Pola pembelajaran di kelas masih terpusat pada guru, sehingga siswa kurang diberi kesempatan untuk mengembangkan kreativitas. Partisipasi siswa belum terlibat secara maksimal dalam proses pembelajaran. Mengingat hal tersebut pengembangan model pembelajaran motivasional bagi siswa merupakan kebutuhan mendesak dan perlu mendapat perhatian. Salah satu pendekatan pembelajaran motivasional yang diyakini mampu meningkatkan motivasi dan hasil belajar siswa adalah pembelajaran kooperatif. Pembelajaran kooperatif adalah pembelajaran yang terdiri dari kelompok-kelompok kecil beranggotakan 4-5 orang yang siswanya bekerja bersama-sama untuk memaksimalkan belajar mereka. Pembelajaran dengan kelompok-kelompok kecil bertujuan untuk meningkatkan pencapaian prestasi belajar. Pembelajaran ini berorientasi pada siswa, yaitu melibatkan siswa secara langsung baik emosional maupun sosial dalam belajar. Lima elemen pokok dalam pembelajaran kooperatif, yaitu: (1) saling ketergantungan positif, (2) interaksi tatap muka, (3) akuntabilitas individu, (4) adanya kesamaan tujuan, dan (5) keterampilan bersosialisasi (menjalin hubungan antara pribadi). Tujuan penelitian ini adalah mendeskripsikan proses dan hasil penerapan pembelajaran kooperatif untuk meningkatkan motivasi dan hasil belajar IPA siswa. Penelitian ini merupakan penelitian tindakan kelas. Penelitian tindakan kelas sangat relevan dengan penerapan pembelajaran kooperatif STAD untuk meningkatkan motivasi dan hasil belajar IPA siswa. Penelitian tindakan kelas dilaksanakan selama 6 kali pertemuan dalam dua siklus melalui empat tahap, yaitu: perencanaan, pelaksanaan tindakan dan evaluasi, pengamatan (observasi), dan refleksi. Subyek penelitian adalah siswa kelas VII A SMP Negeri 1 Kesamben, Kabupaten Blitar semester II tahun pelajaran 2009/2010. Data penelitian berupa motivasi belajar, yang dikumpulkan dengan menggunakan instrument angket dan hasil belajar yang dikumpulkan dengan menggunakan instrument tes. Data motivasi belajar siswa menunjukkan peningkatan dari siklus I dengan nilai rata-rata sebesar 81,25 ke siklus II dengan nilai rata-rata sebesar 82,31. Data hasil belajar ranah kognitif, afektif, dan psikomotor menunjukkan peningkatan perolehan nilai rata-rata dari siklus I ke siklus II. Hasil belajar ranah kognitif pada siklus I nilai rata-rata sebesar 76,09 dan pada siklus II nilai rata-rata sebesar 84,21. Hasil belajar ranah afektif pada siklus I nilai rata-rata sebesar 84,01 dan pada siklus II nilai rata-rata sebesar 86,72. Hasil belajar ranah psikomotor pada siklus I nilai rata-rata sebesar 80,24 dan pada siklus II nilai rata-rata sebesar 90,76. Hasil analisis data menunjukkan bahwa penerapan pembelajaran kooperatif STAD berbantuan komputer untuk meningkatkan motivasi dan hasil belajar IPA siswa SMP Negeri 1 Kesamben, dapat digunakan sebagai salah satu alternatif pembelajaran IPA. Melalui belajar berkelompok mampu memberdayakan siswa untuk berinteraksi lebih lama dengan sesama anggota kelompoknya, dan berpengaruh terhadap motivasi dan hasil belajar. Pemberian penghargaan sebagai bentuk penguatan kepada siswa yang dapat menjawab pertanyaan dengan benar, ternyata mampu memberikan kepuasan, memelihara kerjasama kelompok, dan meningkatkan motivasi siswa dalam belajar. Saran-saran yang dapat dikemukakan berkaitan dengan keberhasilan pembelajaran kooperatif untuk meningkatkan motivasi dan hasil belajar siswa adalah: (1) dianjurkan agar guru menerapkan pembelajaran kooperatif ini dalam pembelajaran IPA di sekolah, (2) pembelajaran kooperatif STAD dapat dijadikan sebagai terobosan baru untuk meningkatkan mutu pembelajaran, (3) hendaknya guru menyampaikan indikator dan tujuan belajar yang hendak dicapai di awal pembelajaran, (4) hendaknya guru memberikan penghargaan (reward) sebagai bentuk penguatan dalam pembelajaran, (5) hasil penelitian ini dapat menjadi bahan masukan bagi peneliti lain dalam upaya meningkatakan mutu pendidikan nasional.

Pengaruh strategi pembelajaran problem based learning (PBL) berbasis multimedia dan kemampuan akademik terhadap kemampuan pemecahan masalah, penguasaan konsep, sikap, dan keterampilan pengelolaan lingkungan siswa SMK Negeri 2 Bondowoso / Rohmawati

 

Kata Kunci: PBL berbasis multimedia, kemampuan pemecahan masalah, penguasaan konsep, sikap, keterampilan pengelolaan lingkungan. Pendidikan yang mampu mendukung pembangunan di masa mendatang adalah pendidikan yang mampu mengembangkan potensi siswa SMK sehingga yang bersangkutan mampu menghadapi dan memecahkan problema kehidupan yang dihadapinya, khususnya di dunia kerja. Sementara pada sisi lain, hasil observasi empirik di lapangan mengindikasikan bahwa sebagian besar lulusan SMK kurang mampu menyesuaikan diri dengan perubahan maupun perkembangan ilmu pengetahuan dan teknologi, sulit untuk bisa dilatih kembali, dan kurang bisa mengembangkan diri (Direktorat Pendidikan Menengah Kejuruan, 2004). Temuan tersebut tampaknya mengindikasikan bahwa pembelajaran di SMK perlu mengembangkan kemampuan adaptasi siswa, di antaranya kemampuan pemecahan masalah. Selain kemampuan pemecahan masalah, kemampuan penguasaan konsep berupa kemampuan ranah kognitif tingkat tinggi perlu dimiliki siswa karena diharapkan dapat mendukung kemampuan siswa dalam memecahkan masalah. Demikian pula aspek sikap perlu dikembangkan untuk mendukung kemampuan adaptasi siswa. Untuk meningkatkan kemampuan-kemampuan tersebut, pembelajaran berbasis masalah atau Problem Based Learning (PBL) adalah jawabannya. Sebagai salah satu lembaga pendidikan kejuruan, SMK Negeri 2 Bondowoso mengemban tugas untuk mengembangkan kemampuan adaptasi siswa melalui kelompok mata pelajaran adaptif. Permasalahannya adalah selama ini pembelajaran adaptif yang dilaksanakan di SMK Negeri 2 Bondowoso, di antaranya mata pelajaran IPA Biologi masih berpusat kepada guru (teacher centered learning), kurang menekankan kepada aktivitas mental siswa sehingga belum dapat mengembangkan kemampuan pemecahan masalah, penguasaan konsep, dan sikap siswa. Oleh karena itu implementasi strategi PBL dalam mata pelajaran IPA Biologi perlu dilakukan melalui langkah penelitian. Strategi pembelajaran PBL dalam penelitian ini diterapkan pada materi lingkungan dengan pertimbangan bumi semakin hari semakin rusak disebabkan oleh rendahnya kepedulian manusia terhadap lingkungannya. Pada umumnya, materi lingkungan sering tidak dapat dihadirkan di dalam kelas, sehingga penggunaan multimedia pada implementasi strategi pembelajaran PBL pada materi lingkungan sangat sesuai karena dapat menampilkan berbagai format. Materi lingkungan terkait erat dengan limbah sehingga aspek psikomotor berupa keterampilan pengelolaan lingkungan selayaknya dimiliki oleh siswa. Mengingat kelas atau rombongan belajar terdiri dari siswa dengan kemampuan akademik yang berbeda, maka aspek heterogenitas kelas menjadi salah satu hal yang diperhatikan dalam penelitian ini. Dengan demikian, langkah penelitian ini dianggap perlu untuk menguji pengaruh strategi PBL berbasis multimedia dan kemampuan akademik terhadap kemampuan pemecahan masalah, penguasaan konsep, sikap, dan keterampilan pengelolaan lingkungan siswa SMK Negeri 2 Bondowoso. Penelitian ini dirancang menggunakan quasi eksperimental (eksperimen semu), dilaksanakan di SMK Negeri 2 Bondowoso pada siswa tingkat XI semester ganjil tahun ajaran 2010/2011, dengan kelas XI A1 sebagai kelas eksperimen dan kelas XI A2 sebagai kelas kontrol. Instrumen yang digunakan dalam penelitian ini adalah lembar observasi pelaksanaan pembelajaran, tes kemampuan pemecahan masalah, tes kemampuan penguasaan konsep, tes sikap, lembar pengamatan kemampuan psikomotor dan lembar penilaian produk daur ulang limbah, serta angket untuk mengetahui respons siswa terhadap pembelajaran PBL berbasis multimedia. Analisis data dilakukan dengan menggunakan Anakova, dilanjutkan dengan uji beda LSD (Least Significant Difference), sedangkan data pelaksanaan kegiatan daur ulang limbah serta data respons siswa dianalisis secara deskriptif. Hasil penelitian menunjukkan bahwa strategi pembelajaran PBL berbasis multimedia berpengaruh signifikan terhadap kemampuan pemecahan masalah dan kemampuan penguasaan konsep siswa, tetapi tidak berpengaruh signifikan terhadap sikap siswa pada lingkungan. Kemampuan akademik berpengaruh signifikan terhadap kemampuan pemecahan masalah, penguasaan konsep, dan sikap siswa pada lingkungan. Interaksi antara strategi pembelajaran PBL berbasis multimedia dan kemampuan akademik tidak berpengaruh signifikan terhadap kemampuan pemecahan masalah, penguasaan konsep, dan sikap siswa pada lingkungan.Rerata nilai keterampilan pengelolaan lingkungan siswa yang belajar dengan strategi pembelajaran PBL berbasis multimedia lebih tinggi dibanding siswa yang belajar dengan strategi pembelajaran konvensional. Respons siswa terhadap penerapan strategi pembelajaran PBL berbasis multimedia sangat positif. Terkait kesimpulan tersebut, maka peneliti menyarankan agar guru mengimplementasikan strategi PBL berbasis multimedia sebagai salah satu strategi pembelajaran IPA Biologi serta mata pelajaran lain di SMK. Karakteristik materi yang disarankan menggunakan strategi PBL yaitu mengandung unsur masalah yang menantang atau merangsang, bersifat interdisipliner, memungkinkan adanya penyelidikan autentik, memungkinkan dihasilkan suatu karya (artefak) dan dipamerkan (exhibit), serta memberi peluang bekerja kolaboratif dalam memecahkan masalah yang dihadapi. Bagi guru yang akan menerapkan strategi pembelajaran PBL berbasis multimedia agar mempertimbangkan kesiapan siswa, kesiapan guru, dan ketersediaan sumber belajar serta fasilitas yang akan digunakan dalam implementasi strategi pembelajaran PBL berbasis multimedia.

Pengaruh customer relationship management (CRM) terhadap loyalitas nasabah / Hendri Widodo

 

Kata kunci: Pengaruh Customer Relationship Management (CRM), loyalitas nasabah Di era perdagangan bebas sekarang ini, tumpuan perusahaan untuk tetap mampu bertahan hidup adalah pelanggan yang loyal. Perusahaan harus jeli dalam melihat perubahan kebutuhan pelanggan, sehingga perusahaan dapat selalu memberikan pelayanan yang sesuai. Untuk menciptakan pelanggan-pelanggan yang setia, perusahaan dituntut untuk melakukan diskriminasi antara pelanggan-pelanggan yang menguntungkan dan yang tidak menguntungkan bagi perusahaan. Salah satu strategi yang bisa diterapkan perusahaan adalah dengan menciptakan relationship (hubungan) antara perusahaan dengan pelanggannya. Strategi tersebut dikenal dengan istilah Customer Relationship Management (CRM). Pepers-Rogers (2004), menjelaskan “CRM (Customer Relationship Management) sebagai strategi pemasaran yang dilakukan perusahaan untuk mengelola hubungan pelanggan bagaimana mengidentifikasi pelanggan, diferensiasi pelanggan, interaksi dengan pelanggan dan mempertahankan pelanggan” Penelitian ini termasuk dalam jenis penelitian kausalitas. Penelitian ini berusaha untuk menjelaskan pengaruh Customer Relationship Management (CRM) yang terdiri dari identifikasi (X1), diferensiasi (X2), interaksi (X3), customize (X4) terhadap loyalitas nasabah baik secara parsial maupun secara simultan. Populasi dari penelitian ini adalah Nasabah yang memiliki tabungan, menjadi debitur dan atau yang menggunakan produk-produk Bank BTN Malang. Sedangkan sampel dalam penelitian ini adalah 100 responden. Sampel diambil dengan menggunakan teknik Stratified Sampling, Proporsional Sampling, dan Accidental Sampling. Hasil penelitian ini menunjukkan bahwa : (1) terdapat pengaruh positif signifikan Customer Relationship Management (CRM) (identifikasi, diferensiasi, interaksi, customize) secara parsial terhadap loyalitas nasabah pada Bank BTN Malang, (2) terdapat pengaruh positif signifikan Customer Relationship Management (CRM) (identifikasi, diferensiasi, interaksi, customize) secara simultan terhadap loyalitas nasabah pada Bank BTN Malang. Dengan demikian dapat disimpulkan bahwa Customer Relationship Management (CRM) dapat mempengaruhi loyalitas nasabah baik secara parsial maupun secara simultan. Identifikasi, diferensiasi, interaksi, customize mempengaruhi loyalitas nasabah pada Bank BTN Malang sebesar 56,3%, sedangkan sisanya 43,7% dipengaruhi oleh faktor-faktor lain diluar penelitian Saran yang dapat berikan berkaiatan dengan temuan yang diperoleh selama pelaksanaan penelitian ini adalah (1) Pelaksanaan CRM yang dilakukan bank BTN Malang harus dipertahankan secara konsisten dan sebaiknya lebih ditingkatkan supaya loyalitas nasabah dapat berlangsung lama, (2) CRM yang khusus mempengaruhi loyalitas nasabah, sekiranya dapat dijadikan acuan untuk membuat perencanaan manajemen yang lebih baik dan efektif demi tercapainya tujuan perusahaan, (3) Menjalankan hubungan baik dengan nasabah tidak hanya dilakukan oleh karyawan-karyawan tertentu saja tetapi sebaiknya juga dilakukan oleh semua karyawan yang secara tidak langsung berhubungan dengan nasabah.

Penerapan pembelajaran dengan pendekatan CTL melalui metode tanya jawab teknik talking stick untuk meningkatkan aktivitas dan hasil belajar siswa dalam mata pelajaran ekonomi kelas VIII SMPN 10 Malang / Tania Dwi Maretawati

 

Kata kunci: Model Pembelajaran talking stick, aktivitas belajar, hasil belajar. Berdasarkan observasi dan wawancara dengan guru mata pelajaran ekonomi di SMP Negeri 10 Malang, diperoleh informasi bahwa proses pembelajaran mata pelajaran ekonomi di kelas masih menggunakan metode ceramah dan tanya jawab. Hal ini menyebabkan siswa kurang aktif dalam pembelajaran, sehingga menimbulkan aktivitas dan hasil belajar siswa menjadi kurang. Untuk mengatasi masalah tersebut diperlukan strategi pembelajaran yang dapat meningkatkan aktivitas dan hasil belajar siswa. Strategi yang diterapkan dalam penelitian ini adalah pembelajaran dengan pendekatan CTL melalui metode tanya jawab teknik talking stick. Penelitian ini bertujuan untuk mengetahui aktivitas dan hasil belajar ekonomi pada siswa kelas VIII F SMP Negeri 10 Malang melalui penerapan pembelajaran dengan pendekatan CTL melalui metode tanya jawab teknik talking stick. Penelitian ini merupakan penelitian tindakan kelas (PTK) yang terdiri dari dua siklus. Data penelitian aktivitas dan belajar siswa yang diperoleh melalui observasi dan hasil belajar siswa diperoleh melalui post test pada setiap akhir siklus. Hasil penelitian menunjukkan bahwa pada siklus I aktivitas siswa sebesar 45,16% dengan kategori “cukup” dan pada siklus II rata-ratanya meningkat menjadi 73,96% dengan kategori “baik”% pada siklus II. Sedangkan aktivitas siswa pada saat diterapkan pembelajaran dengan pendekatan CTL melalui metode tanya jawab teknik talking stick pada siklus I rata-ratanya 66,67% dengan kategori “baik“ dan pada siklus II meningkat menjadi sebesar 13,33% dengan rata-rata sebesar 80% dengan kategori 80% dengan kategori “sangat baik“ dan pada hasil belajar juga mengalami peningkatan, pada siklus I sebesar 76,70% dan pada siklus II menjadi 82,95%. Berdasarkan hasil penelitian maka dapat disimpulkan bahwa penerapan pembelajaran dengan pendekatan CTL melalui metode tanya jawab teknik talking stick dapat meningkatkan aktivitas dan hasil belajar siswa pada mata pelajaran ekonomi siswa kelas VIII F SMP Negeri 10 Malang. Saran yang dapat peneliti sampaikan yaitu agar pembelajaran dengan pendekatan CTL melalui metode tanya jawab teknik talking stick dapat dijadikan salah satu alternatif pilihan bagi guru bidang studi ekonomi untuk meningkatkan aktivitas dan hasil belajar siswa, juga diharapkan adanya penelitian lebih lanjut, untuk menerapkan pada materi yang lain dan dengan sampel yang lebih luas sehingga hasil penelitian bisa berlaku lebih general.

Pengaruh kewirausahaan organisasi dan pengelola, kapabilitas pembelajaran organisasi dan inovasi manajemen terhadap kinerja koperasi primer di Kota Padang Sumatera Barat (analisis model persamaan struktural dengan metode partial least square) / Marwan

 

Kata Kunci: Karakteristik kewirausahaan, kapabilitas pembelajaran, kapabilitas inovasi, kinerja koperasi Tujuan dari penelitian ini adalah untuk mengetahui pengaruh sumberdaya dan kapabilitas internal koperasi yang terdiri dari karakteristik kewirausahaan organisasi dan pengelola, kapabilitas pembelajaran organisasi dan inovasi manajemen terhadap kinerja koperasi primer di Kota Padang Sumatera Barat. Unit analisis dalam penelitian ini adalah koperasi primer di Kota Padang Sumatera Barat. Ukuran sampel sebanyak 97 unit koperasi dan dipilih dengan menggunakan teknik proportional random sampling. Kuesioner digunakan sebagai alat pengumpulan data dan diisi oleh pengelola koperasi sebagai responden penelitian. Analisis data dan pengujian hipotesis menggunakan Structural Equation Modeling (SEM) dengan metode Partial Least Square (PLS). Hasil penelitian menunjukkan bahwa karakteristik kewirausahaan organisasi dan pengelola serta kapabilitas pembelajaran organisasi berpengaruh positif dan signifikan terhadap kapabilitas inovasi manajemen koperasi. Selanjutnya karakteristik kewirausahaan organisasi dan pengelola serta kapabilitas pembelajaran organisasi berpengaruh positif dan signifikan baik secara langsung maupun tidak langsung melalui kapabilitas inovasi manajemen terhadap kinerja koperasi. Secara keseluruhan hasil penelitian ini menunjukkan bahwa sumberdaya dan kapabilitas internal memiliki peran penting dalam meningkatkan kinerja koperasi. Teori Resource Based View (RBV) dapat digunakan untuk memprediksi kinerja koperasi. Teori ini dapat diadopsi dan dikembangkan lebih lanjut dalam kajian kewirausahaan dan manajemen koperasi. Peningkatan kinerja koperasi dapat dilakukan melalui peningkatan kualitas karakteristik kewirausahaan organisasi dan pengelola, peningkatan kapabilitas pembelajaran organisasi dan inovasi manajemen koperasi. Peningkatan kualitas karakteristik kewirausahaan organisasi koperasi dapat dilakukan dengan cara mengembangkan sistem imbalan berbasis kinerja. Koperasi juga dapat mengatur jam kerja yang lebih memadai terutama bagi pengelola yang bekerja paruh waktu di koperasi, merumuskan kontrak kerja yang lebih memberikan keleluasaan bagi pengelola untuk mengambil kebijakan, meningkatkan partisipasi anggota dalam mendukung kinerja pengelola, dan merumuskan aturan organisasi yang lebih fleksibel dalam menghadapi lingkungan eksternal yang semakin dinamis. Peningkatan kualitas karakteristik kewirausahaan pengelola koperasi dapat dilakukan dengan mengikutsertakan pengelola dalam kegiatan pendidikan, latihan dan penyuluhan serta kegiatan magang yang terkait dengan kewirausahaan. Kapabilitas pembelajaran organisasi koperasi dapat ditingkatkan melalui kegiatan lokakarya dan sarasehan yang melibat seluruh pihak seluruh pihak yang terkait dengan koperasi. Kapabilitas inovasi manajemen koperasi dapat ditingkatkan dengan cara mengadakan kegiatan studi banding dan mengadopsi inovasi-inovasi yang telah dilakukan oleh koperasi atau perusahaan lain. Dari aspek pendidikan ekonomi, upaya-upaya peningkatan kinerja koperasi dapat dilakukan melalui semua jenis pendidikan, baik pendidikan formal, non formal maupun informal. Penelitian ini merekomendasikan kepada koperasi untuk menindaklanjuti hasil penelitian ini dengan mengadakan kegiatan evaluasi diri untuk mengkaji, membangun dan mengembangkan sumberdaya dan kapabilitas internal yang dimiliki koperasi. Lembaga pendidikan terkait perlu menyempurnakan materi dan pengembangan kurikulum yang terkait dengan kewirausahaan dan manajemen koperasi. Selanjutnya diikuti dengan pengembangan strategi dan metode serta model-model pendidikan, latihan dan penyuluhan koperasi yang lebih inovatif dan sesuai dengan kebutuhan koperasi. Kerjasama antara berbagai pihak yang terkait dengan peningkatan kinerja koperasi perlu dituangkan dalam bentuk nota kesepahaman. Pengambil kebijakan juga perlu menyempurnakan lagi undang-undang, aturan-aturan dan kebijakan yang dapat memperkuat posisi koperasi dan gerakan koperasi di era global.

Peningkatan kemampuan menulis deskripsi dengan menggunakan strategi pengamatan lingkungan pada siswa kelas IV SDN I Pandean Dongko Trenggalek / Dewi Indiati

 

Kata kunci: kemampuan, menulis deskripsi, strategi pengamatan lingkungan. Pembelajaran menulis deskripsi di sekolah dasar pada dasarnya bertujuan untuk mengembangkan keterampilan siswa dalam mengungkapkan gagasan secara tertulis. Ellis dkk (1989:178) menyatakan bahwa menulis deskripsi merupakan cara yang sangat baik untuk memulai kegiatan menulis. Dengan cara itu, siswa dapat belajar untuk mengamati sesuatu secara rinci kemudian menggambarkannya tertulis. Kemampuan mengamati dan menggambarkan suatu objek dalam bentuk tulisan tidak hanya diperoleh melalui pengetahuan, tetapi juga melalui pengalaman siswa itu sendiri. Siswa dapat menggunakan secara langsung penginderaan yang dimilikinya sesuai dengan karakteristik belajar yang dimilikinya untuk menggambarkan objek. Penelitian ini bertujuan untuk mendeskripsikan upaya peningkatan keterampilan menulis deskripsi dengan menggunakan strategi pengamatan lingkungan pada tahap perencanaan, pelaksanaan, dan evaluasi. Untuk mengetahui peningkatan kemampuan menulis deskripsi, penelitian ini merumuskan masalah sebagai berikut. “Bagaimanakah upaya peningkatan kemampuan menulis deskripsi dengan menggunakan strategi pengamatan lingkungan pada siswa kelas IV Sekolah Dasar Negeri I Pandean Kecamatan Dongko Kabupaten Trenggalek?” (a) “Bagaimanakah upaya proses peningkatan kemampuan menulis deskripsi dengan menggunakan strategi pengamatan lingkungan?” dan (b) “Bagaimanakah upaya peningkatan hasil kemampuan menulis deskripsi berdasarkan strategi pengamatan lingkungan?”. Untuk menjawab pertanyaan di atas, penelitian ini menggunakan pendekatan kualitatif deskriptif dengan rancangan penelitian tindakan kelas. Rancangan penelitian dilaksanakan berdasar tiga siklus tindakan atas kolaborasi antara guru dan peneliti. Setiap siklus tindakan berdasar alur tindakan yang meliputi kegiatan perencanaan, pelaksanaan, pengamatan dan refleksi. Data penelitian berupa informasi mengenai proses tindakan (hasil pengamatan dari perencanaan dan pelaksanaan), serta hasil tes siswa sebelum pelaksanaan kegiatan perbaikan. Hasil tes kegiatan siswa yang dijadikan tindakan di siklus berikutnya apabila taraf penguasaannya kurang dari target pencapaian (70%). Subyek penelititian siswa kelas 4 SDN I Pandean, Dongko, Trenggalek, sejumlah 29 siswa yang secara aktif mengikuti kegiatan tanpa membedakan gender. Hasil evaluasi yang dilakukan setiap akhir kegiatan perlakuan menunjukkan perkembangan yang baik. Taraf penguasaan rata-rata di siklus I (68,9), siklus II (87,3), dan siklus III (89,9). Bertolak dari hasil penelitian tersebut, disarankan agar (1) kepala sekolah dasar disarankan agar memberikan peluang kepada guru untuk menerapkan pembelajaran menulis deskripsi dengan strategi hasil pengamatan lingkungan, (2) guru sekolah dasar disarankan agar hasil penelitian ini dapat dimanfaatkan sebagai salah satu alternatif pembelajaran menulis deskripsi, (3) kepada para peneliti berikutnya kiranya dapat merancang penelitian baru yang berkaitan dengan penerapan strategi hasil pengamatan lingkungan dalam pambelajaran menulis deskripsi di sekolah dasar. Dengan demikian diharapkan siswa sekolah dasar lebih terampil dalam menulis deskripsi.

Pengaruh perhatian dan status sosial ekonomi orang tua terhadap rasionalitas ekonomi siswa di SMAN 7 Malang / Yunita Citra Sari

 

Kata kunci: perhatian orang tua, status sosial ekonomi orang tua, dan rasionalitas ekonomi siswa Rasionalitas ekonomi sebagai sikap yang mencerminkan kecenderungan bertindak sesuai dengan prinsip-prinsip ekonomi, pada dasarnya telah dikenal oleh siswa SMA sejak mereka mengenal aktivitas ekonomi di lingkungan keluarga, maupun masyarakat di sekitar kehidupannya. Dengan status sosial ekonomi orang tua yang tinggi segala kebutuhan anak akan terpenuhi, dan segala keinginannya akan dicukupi, dalam hal ini diperlukan juga perhatian yang tinggi dari orang tua agar kelak anak dapat mengatur sendiri keungannya dan dapat berperilaku rasional dalam berkonsumsi. Tujuan penelitian ini adalah: (1) untuk mendeskripsikan pengaruh perhatian orang tua terhadap rasionalitas ekonomi siswa, (2) untuk mendeskripsikan pengaruh status sosial ekonomi orang tua terhadap rasionalitas ekonomi siswa, (3) untuk mendeskripsikan pengaruh perhatian dan status sosial ekonomi orang tua terhadap rasionalitas ekonomi siswa. Penelitian ini bersifat korelasional dan dilakukan dengan menggunakan pendekatan kuantitatif. Instrumen penelitian yang digunakan adalah angket untuk mengukur perhatian orang tua, status sosial ekonomi orang tua dan rasionalitas ekonomi siswa. Teknik analisis data yang digunakan adalah analisis regresi linier berganda dengan bantuan program SPSS 16.0 for Windows. Populasi dalam penelitian ini meliputi seluruh siswa kelas X dan XI di SMA Negeri 7 Malang dengan jumlah 708 dan berdasarkan rumus Slovin dapat diketahui sampel sebanyak 88 siswa. Teknik sampling yang digunakan dalam penelitian ini adalah simple random sampling. Taraf signifikansi yang digunakan adalah 5%. Hasil penelitian ini menunjukkan bahwa perhatian orang tua dan status sosial ekonomi orang tua siswa di SMAN 7 Malang adalah sedang, sedangkan rasionalitas ekonomi siswa di SMAN 7 Malang adalah tinggi. Dari hasil penelitian berarti apabila ada peningkatan perhatian orang tua (X_1) sebesar satu satuan dan status sosial ekonomi orang tua (X_2) tetap, maka rasionalitas ekonomi siswa (Y) akan meningkat sebesar 0,792. Apabila perhatian orang tua (X_1) dan status sosial ekonomi orang tua (X_2) meningkat satu satuan dan perhatian orang tua (X_1) tetap, maka rasionalitas ekonomi siswa (Y) akan meningkat sebesar 0,315. Sedangkan konstanta sebesar 2,221 artinya jika perhatian orang tua (X_1) dan status sosial ekonomi orang tua (X_2) nilainya 0, maka rasionalitas ekonomi siswa (Y) nilainya adalah 2,221. Sedangkan R-Square sebesar 0,532 menunjukkan bahwa perubahan variabel rasionalitas ekonomi siswa (Y) berkorelasi dengan variasi perubahan variabel perhatian orang tua (X_1) dan status sosial ekonomi orang tua ( X_2) sebesar 53,2%, sisanya sebesar 46,8% perubahan variabel rasionalitas ekonomi siswa (Y) berkorelasi dengan variasi perubahan variabel lain yang tidak dideskripsikan dalam penelitian ini. Dari hasil penelitian yang dilakukan, maka dapat disimpulkan: (1) terdapat pengaruh signifikan positif perhatian orang tua terhadap rasionalitas ekonomi siswa di SMAN 7 Malang, (2) terdapat pengaruh signifikan positif status sosial ekonomi orang tua terhadap rasionalitas ekonomi siswa di SMAN 7 Malang, (3) terdapat pengaruh signifikan positif secara simultan perhatian dan status sosial ekonomi orang tua terhadap rasionalitas ekonomi siswa di SMAN 7 Malang. Saran yang dapat dikemukakan adalah: (1) Mengingat perhatian orang tua dan status sosial ekonomi orang tua berpengaruh terhadap rasionalitas ekonomi siswa, maka hendaknya orang tua berusaha untuk meningkatkan perhatian mereka kepada anaknya. Orang tua hendaknya juga berusa semaksimal mungkin dalam usaha meningkatkan pendapatannya agar dapat mendukung kebutuhan anaknya mengingat hal ini penting bagi masa depan anaknya, (2) Bagi Guru hendaknya berusaha semaksimal mungkin dalam memberikan informasi dan meningkatkan tindakan guru dalam melaksanakan pembelajaran di sekolah, khususnya kecenderungan pola konsumsi yang rasional terhadap produk/jasa yang dibeli peserta didik, (3) bagi peneliti lain yang ingin meneliti tentang rasionalitas ekonomi diharapkan mau menggali dan meneliti faktor-faktor lain yang mempengaruhi rasionalitas ekonomi.

Penerapan pembelajaran berbasis inkuiri dengan the 5 e learning cycle model untuk meningkatkan kemampuan kerja ilmiah dan prestasi belajar siswa kelas VII-I SMPN 2 Pandaan tahun pelajaran 2009/2010 / Ustadi

 

Kata Kunci: prestasi belajar, kemampuan kerja ilmiah, The 5 E Learning Cycle Model. Kurang lengkapnya alat-alat percobaan, banyaknya muatan materi yang harus disampaikan dan banyaknya beban tugas tambahan menyebabkan guru menggunakan metode ceramah dan demonstrasi dalam pembelajaran. Rendahnya kemampuan siswa untuk melakukan penyelidikan, menganalisis data, menyimpulkan, berkomunikasi ilmiah dan bersikap merupakan indikator rendahnya kemampuan kerja ilmiah siswa yang merupakan dampak dari kurangnya keterlibatan siswa dalam proses pembelajaran. Rendahnya nilai ulangan harian siswa merupakan indikator rendahnya prestasi belajar siswa. Oleh karena itu diperlukan suatu model pembelajaran yang menarik dan dapat melibatkan siswa dalam proses pembelajaran. Penerapan pembelajaran dengan the 5 E Learning Cycle Model dapat melibatkan siswa secara aktif pada setiap fase pembelajarannya. Tujuan dari penelitian ini adalah untuk meningkatkan kemampuan kerja ilmiah dan prestasi belajar siswa melalui penerapan pembelajaran IPA berbasis inkuiri dengan the 5 E Learning Cycle Model. Subyek penelitian ini adalah siswa kelas VII-I SMPN 2 Pandaan tahun ajaran 2009/2010, berjumlah 30 siswa. Jenis penelitian yang digunakan adalah penelitian tindakan kelas (PTK) dengan dua siklus. Teknik analisis data dilakukan secara kualitatif deskriptif pada data kemampuan kerja ilmiah dan prestasi belajar siswa serta keterlaksanaan pembelajaran menggunakan persentase. Hasil penelitian menunjukkan bahwa pembelajaran berbasis inkuiri dengan the 5 E Learning Cycle Model dapat meningkatkan kemampuan kerja ilmiah siswa yang ditunjukkan oleh peningkatan persentase seluruh aspek kemampuan kerja ilmiah yang diamati dan prestasi belajar siswa. Prestasi belajar rata-rata siswa yang meningkat terdiri dari 66,33 pada siklus I meningkat menjadi 76,17 pada siklus II dengan jumlah siswa yang telah mencapai ketuntasan dari 11 siswa atau 37% menjadi 22 siswa atau 73,33% dari seluruh siswa.

Pengembangan perangkat pembelajaran IPA biologi SMP berbasis inkuiri terbimbing dipadu kooperatif STAD serta pengaruhnya terhadap kemampuan berpikir tingkat tinggi, metakognisi, dan keterampilan proses sains pada siswa berkemampuan akademik atas dan bawah / Baskoro Adi

 

Kata kunci: Inkuiri, STAD, berpikir, metakognisi, keterampilan proses sains Biologi terdiri dari aspek produk dan proses. Pembelajaran Biologi di Indonesia sebagian besar terbatas pada aspek produk. Pembelajaran yang terbatas pada aspek produk menyebabkan pembelajaran berbasis isi. Keberhasilan pembelajaran berbasis isi diukur dari banyaknya konsep yang berhasil dihafalkan oleh siswa, akibatnya kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains siswa memprihatinkan. Permasalahan penting lainnya adalah mensejajarkan prestasi belajar siswa berkemampuan akademik bawah (AB) dengan siswa berkemampuan akademik atas (AA). Vygotsky menyatakan, siswa AA dan AB dapat sejajar prestasi belajarnya, jika memperoleh scaffolding dari guru dan teman sebayanya. Strategi pembelajaran yang berpotensi menyelesaikan permasalahan tersebut adalah Inkuiri terbimbing dan STAD. Inkuiri terbimbing terbukti mampu melatihkan berpikir tinggi, metakognisi, dan keterampilan proses sains. Strategi STAD terbukti mampu melatihkan berpikir tinggi dan metakognisi, selain itu kegiatan diskusi pada strategi STAD mampu memfasilitasi proses scaffolding melalui tutorial sebaya. Integrasi sintaks inkuiri terbimbing dan STAD berpotensi mampu meningkatkan kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains, serta mampu mensejajarkan prestasi belajar siswa AA dan AB. Tujuan penelitian terdiri dari tujuan penelitian pengembangan dan eksperimen. Penelitian pengembangan bertujuan mengembangkan perangkat pembelajaran. Penelitian eksperimen bertujuan sebagai berikut. (1) Mengetahui pengaruh strategi pembelajaran terhadap kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains. (2) Mengetahui pengaruh kemampuan akademik terhadap berpikir tinggi, metakognisi, dan keterampilan proses sains. (3) Mengetahui pengaruh interaksi strategi pembelajaran dengan kemampuan akademik terhadap kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains. Tahap pengembangan merujuk pada Borg & Gall yaitu, tahap analisis kebutuhan, tahap pengembangan, dan tahap uji coba produk. Rancangan eksperimen menggunakan kuasi eksperimen pretes-postes non equivalent control group design. Variabel bebas adalah strategi pembelajaran dan kemampuan akademik. Variabel terikat adalah kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains. Populasi penelitian adalah seluruh siswa kelas VII SMPN di Surakarta. Penarikan sampel menggunakan stratifield random sampling untuk menetapkan 8 sampel sekolah. Setiap sampel sekolah diambil 1 sampel kelas secara acak. Sampel penelitian sebanyak 136 orang siswa terdiri dari masing-masing 68 orang siswa AA dan AB. Kemampuan berpikir tinggi dan keterampilan proses sains diukur menggunakan tes esai. Kemampuan metakognisi diukur menggunakan MAI (metacognitive awarness inventory) dan rubrik metakognisi. Instrumen terlebih dahulu diuji validitas, reliabilitas, tingkat kesukaran, dan daya beda. Data diambil saat pretes dan postes. Analisis data menggunakan analisis deskriptif dan anakova dilanjutkan uji LSD. Sebelum uji anakova, dilakukan uji asumsi normalitas dan homogenitas varians. Uji normalitas menggunakan uji Kolmogorov-Smirnov. Uji homogenitas menggunakan uji Levene’s. Semua penghitungan menggunakan program SPSS versi 16,0 pada taraf signifikansi 0,05 (P < 0,05). Hasil pengembangan menunjukkan perangkat pembelajaran andal dalam meningkatkan kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains. Hasil eksperimen sebagai berikut. (1) Strategi belajar berpengaruh terhadap kemampuan berpikir tinggi, metakognisi yang diukur menggunakan rubrik, dan keterampilan proses sains. Strategi belajar tidak berpengaruh terhadap kemampuan metakognisi yang diukur menggunakan MAI. (2) Terdapat perbedaan kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains pada kemampuan AA dan AB. (3) Terdapat pengaruh interaksi strategi pembelajaran dengan kemampuan akademik terhadap kemampuan berpikir tinggi dan metakognisi yang diukur menggunakan rubrik. Tidak terdapat pengaruh interaksi strategi pembelajaran dengan kemampuan akademik terhadap kemampuan metakognisi yang diukur menggunakan MAI dan keterampilan proses sains. Strategi inkuiri terbimbing, STAD, dan gabungan (inkuiri-STAD) mampu memberdayakan berpikir tinggi, metakognisi, dan keterampilan proses sains. Strategi gabungan (inkuiri-STAD) andal dalam memberdayakan kemampuan berpikir tinggi. Strategi gabungan (inkuiri-STAD) andal dalam memberdayakan kemampuan metakognisi dan keterampilan proses sains setara dengan strategi inkuiri terbimbing. Interaksi strategi pembelajaran dengan kemampuan akademik menunjukkan, strategi STAD dan gabungan (inkuiri-STAD) mampu mensejajarkan kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains pada siswa AA dan AB. Strategi inkuiri terbimbing dan konvensional kurang mampu mensejajarkan kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains pada siswa AA dan AB. Persentase pergeseran rata-rata skor berpikir tinggi, metakognisi, dan keterampilan proses sains dari pretes ke postes pada strategi inkuiri terbimbing, STAD, dan gabungan (inkuiri-STAD) menunjukkan, siswa AB memiliki nilai lebih tinggi dibandingkan siswa AA. Guru disarankan menerapkan strategi gabungan (inkuiri-STAD) untuk melatihkan kemampuan berpikir tinggi, metakognisi, dan keterampilan proses sains. Pembentukan kelas dengan kemampuan akademik homogen perlu dipertimbangkan, karena menyebabkan tidak efektifnya proses scaffolding. Pembelajaran berbasis kompetisi menyebabkan kesenjangan prestasi belajar siswa AA dan AB, perlu dipertimbangkan penggunaan pembelajaran berbasis kooperatif, baik diterapkan secara mandiri atau digabung dengan strategi lain dalam pembelajaran biologi.

Pengaruh peluang kebangkrutan, pertumbuhan perusahaan, kualitas auditor, dan opini audit tahun sebelumnya terhadap kecenderungan pemberian opini audit going concern (pada perusahaan perbankan yang terdaftar di Bursa Efek Indonesia periode 2006-2009) / Ayunda Putri Natal

 

Kata Kunci: Opini Audit, Going Concern, Peluang Kebangkrutan, Pertumbuhan Perusahaan, Kualitas Auditor, Regresi Logistik. Opini audit going concern adalah suatu pendapat yang diberikan oleh auditor setelah melaksanakan prosedur audit yang didalamnya ditambahkan paragraf penjelasan tentang ketidakmampuan perusahaan untuk dapat bertahan dalam bisnis. Dalam kecenderungan pemberian opini audit going concern dapat dipengaruhi oleh peluang kebangkrutan (Purba 2009:86), yang didalamnya terdapat analisa rasio yang dapat mengukur tingkat kegagalan usaha. Opini audit going concern juga dipengaruhi oleh pertumbuhan perusahaan yang dilihat dari kenaikan atau penurunan rasio (Purba 2009:90), indikator yang lain juga dapat dilihat dari kualitas auditor yang diberikan oleh KAP (Chow dkk: 1987 dalam Manao & Nursetyo: 2002). Sesuai dengan teori positif Feltham dan Demski kecenderungan pemberian opini audit going concern juga dapat dipengaruhi oleh opini audit tahun sebelumnya, apabila pada tahun sebelumnya auditor memberikan opini audit going concern maka auditor juga cenderung memberikan opini yang sama pada tahun audit. Tujuan dari penelitian ini adalah mengetahui adanya pengaruh peluang kebangkrutan, pertumbuhan perusahaan, kualitas auditor, dan opini audit tahun sebelumnya terhadap kecenderungan pemberian opini audit going concern. Pemilihan sampel ditentukan dengan menggunakan purposive sampling method dan menggunakan pool time series, sehingga diperoleh sebanyak 72 perusahaan perbankan yang terdaftar di Bursa Efek Indonesia periode 2006-2009. Pada penelitian ini peluang kebangkrutan diproksikan dengan Revised Z-Score, pertumbuhan perusahaan diproksikan dengan pertumbuhan laba, kualitas auditor diproksikan dengan reputasi kantor akuntan publik, dan opini audit tahun sebelumnya diproksikan dengan going concern audit opinion (GCAO) dan non going concern audit opinion (NGCAO). Analisis yang digunakan pada penelitian ini adalah regresi logistik (logistic regression). Hasil penelitian menunjukkan bahwa variabel peluang kebangkrutan, pertumbuhan perusahaan, kualitas auditor, dan opini audit tahun sebelumnya memiliki nilai sig. > 0,05 sehingga tidak berpengaruh terhadap kecenderungan pemberian opini audit going concern . Hal ini dikarenakan kondisi perekonomian Indonesia yang labil pada periode penelitian yang diambil, yaitu tahun 2006 dan 2007 menuju masa perbaikan, tahun 2008 mengalami krisis, dan mencoba memperbaiki pada tahun 2009 sehingga auditor takut untuk memberikan opini audit going concern karena kekawatiran akan kembali terjadi bank panic, selain itu juga judgement auditor akan rencana manajemen yang dianggap mampu untuk mengatasi masalah kelangsungan hidup perusahaan.

Penerapan pembelajaran berdasarkan masalah melalui pembelajaran kooperatif tipe STAD untuk meningkatkan motivasi dan hasil belajar IPA pada siswa kelas VIIA SMP Negeri 1 Pasuruan / Linamik

 

Kata kunci: Pembelajaran berdasarkan Masalah, Pembelajaran Kooperatif STAD, Motivasi, dan Hasil Belajar Guru IPA kelas VIIA SMP Negeri 1 Pasuruan menyatakan bahwa motivasi dan hasil belajar siswa masih rendah. Motivasi yang rendah ditunjukkan dengan adanya rendahnya perhatian siswa terhadap pelajaran dan rendahnya rasa percaya diri siswa terhadap pelajaran IPA. Guru IPA masih banyak yang menyukai metode ceramah sehingga siswa lebih bersifat pasif. Siswa kurang dapat kesempatan menemukan konsepnya sendiri karena lebih banyak menerima informasi dari guru. Berdasarkan permasalahan tersebut maka diterapkan pembelajaran berdasarkan masalah melalui pembelajaran kooperatif STAD untuk meningkatkan motivasi dan hasil belajar IPA pada siswa kelas VII SMP Negeri 1 Pasuruan. Penelitian ini adalah Penelitian Tindakan Kelas (PTK) dengan pendekatan kualitatif. PTK ini dilaksanakan dalam dua siklus, tiap siklus empat pertemuan. Setiap siklus terdiri dari perencanaan, tindakan, observasi, dan refleksi. Subjek penelitian adalah seluruh siswa kelas VIIA SMP Negeri Pasuruan, semester genap tahun ajaran 2009-2010 yang berjumlah 26 orang. Penelitian dilaksanakan pada pada bulan April sampai bulan Mei 2010. Instrumen yang digunakan dalam penelitian ini adalah lembar observasi keterlaksanaan tindakan oleh guru dan siswa, catatan lapangan, angket motivasi belajar, tes hasil belajar kognitif, laporan dan poster, angket hasil belajar afektif, lembar observasi hasil belajar psikomotor. Hasil belajar kognitif diperoleh dari tes hasil belajar kognitif akhir siklus, laporan, dan poster. Hasil penelitian menunjukkan bahwa pembelajaran berdasarkan masalah melalui pembelajaran kooperatif STAD dapat meningkatkan motivasi dan hasil belajar siswa kelas VIIA SMP Negegeri 1 Pasusuruan. Peningkatan motivasi dapat dilihat dari rata-rata nilai motivasi siswa pada siklus I 80,96 dan pada siklus II 87,62. Hasil belajar siswa juga mengalami peningkatan. Hasil belajar siswa meliputi: hasil belajar kognitif, hasil belajar afektif, dan hasil belajar psikomotor. Peningkatan hasil belajar kognitif dapat dilihat dari ketuntasan klasikal pada siklus I 76,92% dan pada siklus II 100%. Rata-rata kelas pada siklus I 78,69 dan pada siklus II 87,39 tetapi masih perlu perbaikan pada kemampuan menganalisis dan mengevaluasi suatu permasalahan. Hasil belajar afektif pada siklus I ketuntasan klasikal mencapai 80,77% dan pada siklus II 92,31% Ketuntasan klasikal hasil belajar psikomotor pada siklus I 84,62% dan pada siklus II 92,31%. Berdasarkan hasil penelitian di atas, disimpulkan bahwa pembelajaran berdasarkan masalah melalui pembelajaran kooperatif STAD dapat meningkatkan motivasi dan hasil belajar siswa kelas VIIA SMP Negeri 1 Pasusuruan.

Penerapan strategi open ended problem bersetting kooperatif untuk meningkatkan kreativitas dan pemahaman pecahan bagi siswa kelas VII SMP PGRI 6 Malang / Hena Dian Ayu

 

Kata Kunci: Bilangan Pecahan, Kreativitas, Open Ended Problem , Kooperatif. Bilangan pecahan merupakan materi matematika yang merupakan dasar dalam belajar matematika dan ilmu pelajaran lain. Pada bidang matematika, ilmu pengetahuan lain, maupun dalam kehidupan sehari-hari, penggunaan bilangan pecahan tidak dapat dihindari. Misalkan besar tingkat pertumbuhan ekonomi, suku bunga bank, keuntungan, diskon, kekuatan getaran gempa, pelajaran optik, dan lain sebagainya semuanya dinyatakan dalam bilangan pecahan. Untuk itu penguasaan terhadap materi bilangan pecahan sangat perlu. Pada kenyataannya skor tes materi bilangan pecahan sangat rendah. Kreativitas adalah kemampuan untuk menyusun atau menemukan sesuatu yang baru dalam matematika, merupakan kombinasi berpikir logis dan berpikir divergen yang memperhatikan fleksibilitas, kefasihan, dan kebaruan dalam memecahkan maupun mengajukan masalah. Kreativitas penting dalam hidup karena dengan berkreasi orang dapat mewujudkan dirinya, karena perwujudan diri merupakan salah satu kebutuhan pokok dalam hidup manusia. Pada kenyataannya pembelajaran yang terjadi selama ini umumnya kurang menekankan bagaimana siswa agar mengkonstruksi pengetahuan dan kreativitasnya. Pembelajaran Open Ended Problem Bersetting Kooperatif merupakan pembelajaran dimana guru menyajikan permasalahan yang mempunyai banyak jawaban, kemudian siswa mendiskusikannya dalam kelompok belajara dan mempresentasikan hasil diskusi serta pada akhirnya guru menyimpulkan hasil diskusi siswa mengenai materi atau konsep apa yang didapatkan siswa. Penelitian ini menggunakan pendekatan kualitatif dengan rancangan penelitian tindakan kelas. Penelitian ini dilaksanakan pada siswa kelas VII-B SMP PGRI 6 Malang pada semester I. Rumusan masalah dalam penelitian ini adalah bagaimanakah penerapan strategi open ended problem bersetting kooperatif yang dapat meningkatkan kreativitas dan pemahaman siswa?. Tujuan penelitian ini sejalan dengan rumusan masalah yaitu untuk (1) mendeskripsikan bagaimana penerapan strategi open ended problem bersetting kooperatif yang dapat meningkatkan kreativitas dan pemahaman. Langkah pembelajaran berpijak pada 5 komponen model pembelajaran Joyce dan Weil (1992) yaitu, (1) sintaks, (2) sistem sosial, (3) prinsip reaksi, (4) sistem pendukung, dan (5) dampak instruksional dan pengiring. Sintaks pada pembelajaran ini terdiri dari 6 fase yaitu, (1) orientasi, (2) pembekalan dan penyajian masalah, (3) pengerjaan masalah secara individu, (4) diskusi kelompok, (5) presentasi, dan (6) penutup. Berdasarkan data tes hasil belajar pada Tindakan I dapat disimpulkan untuk pemahaman 63,3% siswa yang memperoleh skor lebih dari 65(tuntas) di bidang pemahaman dan 60% siswa yang mengalami peningkatan skor di atas kategori cukup di bidang kreativitas. Pada Tindakan II untuk pemahaman jumlah siswa yang tuntas mengalami peningkatan yaitu 66,67% dan dari segi kreativitas jumlah siswa yang tuntas juga mengalami peningkatan yaitu 76,67%. Nilai rata-rata kelas juga mengalami peningkatan dari Tindakan I ke Tindakan II, yaitu dari 59 menjadi 64,3. Berdasarkan data hasil pengamatan terhadap aktivitas siswa dapat disimpulkan bahwa terdapat perubahan dari Tindakan I ke Tindakan II yaitu 72,9% (cukup) menjadi 85,42% (baik). Dengan kata lain terdapat peningkatan terhadap aktivitas siswa dari Tindakan I ke Tindakan II. Kesimpulan dari hasil penelitian ini adalah bahwa kreativitas dan pemahaman siswa dengan penerapan strategi open ended problem bersetting kooperatif adalah meningkat.

Hubungan antara kepercayaan diri dengan perilaku merokok siswa di SMA Shalahuddin Malang / Lydia Sepvirna Eka Putri

 

Kata kunci: kepercayaan diri, perilaku merokok, remaja. Kepercayaan diri adalah perasaan yakin akan kemampuan dan kekuatan diri sendiri yang membantu seseorang bersikap positif terhadap dirinya dan orang lain. Perilaku merokok adalah aktivitas menghisap atau menghirup asap rokok dengan menggunakan pipa atau rokok yang dilakukan secara menetap. Penelitian ini bertujuan untuk: (1) Mengetahui gambaran kepercayaan diri siswa (2) Mengetahui gambaran perilaku merokok siswa, (3) Mengetahui apakah ada hubungan antara kepercayaan diri dengan perilaku merokok siswa. Subyek penelitian adalah siswa SMA Shalahuddin Malang yang merokok sebanyak 40 siswa sebagai sampel penelitian. Instrumen dalam penelitian ini menggunakan dua skala yaitu skala kepercayaan diri dan skala perilaku merokok. Teknik analisis data menggunakan analisis deskriptif dan analisis korelasional product moment. Hipotesis dalam penelitian ini yaitu Ada hubungan antara kepercayaan diri dengan perilaku merokok siswa di SMA Shalahuddin Malang. Hasil penelitian menunjukkan bahwa 13 siswa (32,5%) memiliki kepercayaan diri tinggi, 11 siswa (27,5%) memiliki kepercayaan diri sedang dan 16 siswa (40%) memiliki kepercayaan diri dengan klasifikasi rendah. Serta 16 siswa (40%) memiliki perilaku merokok tinggi, 12 siswa (30%) memiliki perilaku merokok sedang, dan 12 siswa (30%) memiliki perilaku merokok rendah. Hasil penelitian korelasional product moment didapatkan nilai rxy = -0,315 dengan taraf siginifikasi sebesar 0,048 (sig < 0,05). Hal ini menunjukkan ada korelasi negatif antara kepercayaan diri dengan perilaku merokok, yaitu semakin tinggi kepercayaan diri siswa, maka akan semakin rendah perilaku merokok siswa. Berdasarkan penelitian tersebut, peneliti memberikan saran kepada beberapa pihak yaitu: 1) Bagi sekolah Agar lebih memotivasi serta membantu dan memberikan penyuluhan peserta didiknya dalam mengembangkan kepercayaan diri agar tidak terjerumus dalam kenakalan remaja. 2) Bagi siswa Agar remaja lebih memahami pentingnya kepercayaan diri sehingga mampu mengembangkan diri secara optimal, mengerti akan bahaya merokok dan menghindarkan diri dari perilaku merokok.3) Bagi orang tua dan pengajar Agar dapat memberikan bantuan psikologis serta melakukan pendekatan kepada remaja agar dapat mengembangkan kepercayaan diri, dan memberikan contoh serta arahan agar remaja dapat terhindar dari perilaku merokok.4)Bagi peneliti selanjutnya Diharapkan dapat mengadakan penelitian pada subjek yang lebih luas dan menggunakan instrumen pengumpulan data yang lebih

Pengaruh atribut produk terhadap keputusan pembelian konsumen pasta gigi Pepsodent (studi pada ibu-ibu PKK Kelurahan Mojolangu Malang) / Sumantri

 

Kata kunci: atribut produk, harga, kemasan, kualitas, keputusan pembelian. Kesehatan merupakan harta paling berharga dalam hidup ini, begitulah kira-kira bunyi sebuah pepatah yang pernah peneliti baca. Ya, kesehatan memang sebuah harta yang sangat berharga bagi manusia. Apalah artinya uang berlimpah jika tubuh dalam kondisi sakit, makan tak enak, tidurpun tak nyenyak. Kesehatan tidak begitu saja dimiliki seseorang, dibutuhkan upaya untuk mendapatkan dan menjaganya. Salah satu kesehatan yang harus dijaga oleh seseoarang adalah kesehatan gigi dan mulut. Untuk itu, saat ini begitu banyak produk yang fungsinya untuk menjaga kesehatan gigi dan mulut, Salah satunya yaitu pasta gigi. Berbicara masalah pasta gigi, saat ini banyak sekali jenis-jenis pasta gigi yang beredar dipasaran. Seperti pasta gigi Pepsodent, Formula, Close Up, Ritadent, Ciptadent, dll. Kesemua jenis pasta gigi tersebut pada dasarnya fungsinya sama, yaitu digunakan untuk menjaga kesehatan gigi dan mulut. Namun dalam perkembangannya, diantara produk-produk tersebut memiliki ciri tersendiri, terutama dalam hal fungsi-fungsi tambahan yang diberikan oleh produk-produk tersebut. Hal tersebut tidak lain bertujuan untuk mendukung kesuksesan program pemasaran yang disusun oleh perusahaan. Sehingga pada akhirnya, produk mereka diperhitungkan oleh konsumen. Untuk dapat menarik konsumen agar melakukan pembelian, salah satunya dapat dilakukan dengan kreatifitas penciptaan atribut produk yang menarik bagi konsumen. Atribut produk dalam beberapa penelitian dan buku-buku tentang pemasaran dinyatakan sebagai komponen yang dipertimbangkan oleh konsumen sebelum mengambil keputusan pembelian. Namun tentunya antara jenis produk yang satu dengan produk yang lainnya memiliki perbedaan mana atribut produk yang dipertimbangkan oleh konsumen dan mana yang tidak. Berdasarkan penjelasan diatas maka peneliti tertarik melakukan penelitian tentang Atribut Produk. Penelitian ini bertujuan untuk mengetahui pengaruh Atribut Produk (X) yang terdiri dari Faktor Harga (X1) dan Kemasan (X2) dan faktor Kualitas (X3) secara parsial maupun simultan terhadap Keputusan Pembelian Konsumen (Y). Dalam penelitian ini teknik pengambilan sampel yang digunakan adalah teknik Accidental Sampling yaitu menentukan sampel berdasarkan kebetulan, dimana jumlah sampel yang diambil sebanyak 107 orang ibu-ibu anggota PKK Kelurahan Mojolangu Malang. Skala yang digunakan adalah Skala Likert dengan 5 (lima) opsi pilihan jawaban. Untuk menguji kelayakan instrumen digunakan uji validitas dan reliabilitas. Teknik pengumpulan data dalam penelitian ini menggunakan kuesioner, dokumentasi, observasi dan wawancara. Penelitian ini menggunakan teknik analisis deskriptif dan analisis regresi linear berganda dengan menggunakan SPSS for windows Versi 16.0. Berdasarkan hasil penelitian diketahui bahwa variabel Atribut Produk (X) yang terdiri dari Faktor Harga (X1) Faktor Kemasan (X2) dan faktor Kualitas (X3) secara parsial mempunyai pengaruh positif signifikan terhadap Keputusan Pembelian Konsumen pasta gigi Pepsodent. Adanya pengaruh tersebut ditunjukkan dengan nilai signifikansi dari uji t dari masing-masing variabel < 0,05. Dimana nilai tersebut berturut-turut sebagai berikut: untuk Faktor Harga (X1) mempunyai nilai signifikansi 0,001, Faktor Kemasan (X2) mempunyai nilai signifikansi 0,002 dan Faktor Kualitas (X3) mempunyai nilai signifikansi 0,003. Selain itu juga ditunjukkan dengan nilai t hitung untuk Faktor Harga = 3,348 > nilai t tabel = 1,982, Faktor Kemasan nilai t hitung = 3,244 > nilai t tabel = 1,982, dan untuk Faktor Kualitas = 2,994 > nilai t tabel = 1,982. Secara simultan Faktor Harga (X1), Faktor Kemasan (X2) dan faktor Kualitas (X3) juga mempunyai pengaruh positif yang signifikan terhadap Keputusan Pembelian Konsumen pasta gigi Pepsodent. Pengaruh tersebut ditunjukkan dengan nilai signifikansi F sebesar 0,000 ≤ 0,05 dan ditunjukkan oleh nilai F hitung = 25,207 > F tabel = 2,70. Selain itu diketahui pula bahwa nilai Adjusted R Square sebesar 0,409. Dapat diinterpretasikan bahwa variabel Atribut Produk Faktor Harga, Faktor Kemasan dan Faktor Kualitas mempengaruhi keputusan pembelian konsumen dalam berbelanja produk pasta gigi Pepsodent sebesar 40,9 % dan sisanya sebesar 59,1 % dipengaruhi oleh variabel-variabel lain di luar penelitian. Berdasarkan hasil penelitian ini, dapat disarankan kepada produsen pasta gigi Pepsodent sebaiknya selalu meningkatkan atau mempertahankan atribut produk yang sudah ada saat ini, selain itu sebaiknya juga menciptakan produk yang mempunyai dua macam kualitas dalam satu produk. Misalnya, kombinasi antara Pepsodent Center Fresh dan Pepsodent Pencegah Gigi Berlubang. Apabila peneliti di masa mendatang ingin menggunakan variabel Atribut Produk, peneliti menyarankan agar menambahkan variabel merek sebagai sub variabel bebasnya. Hal ini untuk mengetahui apakah variabel merek juga mempengaruhi keputusan pembelian konsumen pasta gigi pepsodent yang belum terjawab dalam penelitian ini.

Permasalahan permodalan pada beberapa usaha kecil di Kota Malang / Dika Listyaningtyas

 

Kata kunci: Implementasi, KTSP, Ekonomi Pendidikan pada dasarnya merupakan proses untuk membantu manusia dalam mengembangkan dirinya sehingga mampu menghadapi setiap perubahan yang terjadi. Untuk mendukung pendidikan yang bermutu maka dibutuhkan kurikulum yang bermutu pula. Pada 7 Juli 2006 diresmikan Kurikulum Tingkat Satuan Pendidikan (KTSP). Kurikulum ini berusaha mengakomodir kepentingan daerah. Penelitian ini bertujuan untuk mendeskripsikan implementasi Kurikulum Tingkat Satuan Pendidikan (KTSP). Ada 3 hal yang dideskripsikan berkaitan dengan implementasi Kurikulum Tingkat Satuan Pendidikan (KTSP), yaitu (1) persepsi guru ekonomi mengenai KTSP; (2) implementasi KTSP pada pembelajaran ekonomi, yang dilihat dari silabus, (RPP), proses pembelajaran dan teknik penilaian kelas; (3) faktor pendukung dan faktor penghambat dalam implementasi KTSP pada pembelajaran ekonomi. Dengan lokasi penelitian yang dipilih adalah SMAI Al Maarif Singosari Kabupaten Malang Pendekatan yang digunakan dalam penelitian ini adalah pendekatan kualitatif Deskriptif. Data yang digunakan berasal dari data primer dan data sekunder. Data primer berasal dari pengamatan (observasi) dan wawancara kepada Wakil Kepala Bidang Kurikulum, 2 guru ekonomi dan 14 siswa yang berasal dari kelas X dan XI. Data sekunder berasal dari dokumen perangkat pembelajaran. Analisis Data dengan cara membandingkan dengan benchmark dan analisis content. Hasil penelitian menunjukkan bahwa persepsi dan pemahaman guru mata pelajaran ekonomi di SMAI Al Maarif Singosari Kabupaten Malang masih berkisaran mengenai pengetahuan umum saja sedangkan hal-hal yang bersifat khusus tidak bisa menjelaskan secara rinci-rinci. Dalam pengembangan komponen Kurikulum Tingkat Satuan Pendidikan (KTSP) yang berupa silabus Rencana Pelaksanaan Pembelajaran (RPP), guru memiliki kemampuan untuk mengembangkan sesuai dengan acuan yang dipaparkan pada Kurikulum Tingkat Satuan Pendidikan (KTSP). Proses implementasi Kurikulum Tingkat Satuan Pendidikan (KTSP) pada pembelajaran tidak sesuai dengan apa yang direncanakan. Implementasi tidak sesuai dengan yang direncanakan karena keterbatasan alokasi waktu, kekurangmampuan guru mengkondisikan pembelajaran yang menyenangkan dan karakteristik siswa yang masih belum terbiasa dengan pembelajaran yang menekankan keaktifan siswa sehingga penggunaan strategi pembelajaran kurang, penggunaan sumber pembelajaran dan media pembelajaran juga menjadi tidak optimal. Dari sisi teknik penilaian proses pembelajaran yaitu dengan menggunakan teknik penilaian berbasis kelas dengan melihat aspek kognitif dan afektif siswa di saat dan sesudah proses pembelajaran. Faktor pendukukung implementasi Kurikulum Tingkat Satuan Pendidikan (KTSP) adalah cukup tersedianya sarana dan prasarana dalam mendukung proses pembelajaran serta aktifnya pihak sekolah dalam mengirimkan guru-guru untuk mengikut seminar, penyuluhan dan workshop mengenai Kurikulum Tingkat Satuan Pendidikan (KTSP). Faktor penghambat dalam implementasi Kurikulum Tingkat Satuan Pendidikan (KTSP) adalah kemampuan guru yang kurang dalam mengoptimalkan sumber belajar, media pembelajaran, dan metode pembelajaran dalam proses pembelajaran dan karakteristik siswa yang masih terbiasa dengan sistem pembelajaran 1 arah. Dari hasil penelitian ini disarankan agar guru lebih sering lagi mengkuti seminar-seminar. Seminar bukan hanya mengenai Kurikulum Tingkat Satuan Pendidikan (KTSP) tetapi juga mengenai peningkatan mutu guru dalam kecakapam menggunakan media pembelajaran berbasis informasi dan teknologi, strategi pembelajaran dan metode pembelajaran yang efektif. Selain itu guru disarankan untuk lebih berani untuk menerapkan metode media dan sumber pembelajaran yang bervariasi meskipun karakteristik siswa masih terbiasa dengan cara belajar metode ceramah 1 arah hal ini agar membiasakan siswa pada pembelajaran sesuai Kurikulum Tingkat Satuan Pendidikan (KTSP).

Pengaruh tindakan supervisi terhadap kinerja junior auditor dengan konflik peran sebagai variabel intervening / Anggi Swandayani

 

Kata Kunci: Tindakan Supervisi, Kinerja Junior Auditor, Konflik Peran Sumber Daya Manusia dalam suatu organisasi merupakan penentu yang sangat penting bagi keefektifan berjalannya kegiatan di dalam organisasi. Kinerja seseorang akan dipengaruhi oleh tingkat kepuasan kerja yang dimiliki. Dalam lingkungan Kantor Akuntan Publik (KAP), perlu adanya pemeliharaan kualitas atau mutu pemeriksaan auditor serta tidak lupa produktivitas para akuntannya. Analisis terhadap fungsi-fungsi supervisi dan stres peran menunjukkan adanya fungsi spesifik supervisi yang berkorelasi dengan rendahnya tingkat ambiguitas peran. Tujuan dari penelitian ini adalah untuk mengetahui apakah tindakan supervisi berpengaruh signifikan terhadap kinerja junior auditor serta untuk mengetahui apakah tindakan supervisi dengan konflik peran berpengaruh signifikan terhadap kinerja junior auditor. Penelitian dilakukan pada Senior Auditor dan Junior Auditor yang bekerja pada 7 Kantor Akuntan Publik (KAP) di Kota Malang menggunakan analisis jalur. Populasi dalam penelitian ini sebanyak 35 responden pada 7 KAP. Pengambilan sampel menggunakan Purposive Sampling. Analis data dilakukan dengan menggunakan SPSS for Windows 16,0 Setelah dilakukan proses pengolahan data dan analisis jalur diketahui hasil penelitian menyatakan (1) Tindakan Supervisi mempunyai pengaruh yang signifikan terhadap Kinerja Junior Auditor (2) Konflik Peran mempunyai pengaruh yang signifikan terhadap Kinerja Junior Auditor namun konflik peran tidak dapat tidak dapat memediasi pengaruh tindakan supervisi terhadap kinerja junior auditor. Hasil pengujian hipotesis dalam penelitian ini juga memperkuat Teori Motivasi Maslow serta Teori X dan Y dari Mc. Gregor. Hasil ini juga mendukung penelitian terdahulu yang dilakukan oleh Hadi (2007) dan Cahyono (2005:676). Saran yang dapat diberikan penulis bagi Kantor Akuntan Publik (KAP) antara lain (1) Kantor Akuntan Publik diharapkan benar-benar memperhatikan saat akan melakukan rekruitmen atas auditornya. (2) pelaksanaan tindakan supervisi dalam KAP sebaiknya memperhatikan etika dan tata cara melaksanakan supervisi dengan baik agar pelaksanaan supervisi dapat berjalan secara efektif dan kinerja junior auditor dapat ditingkatkan. (3) KAP melalui auditor-auditor serta karyawan lainnya sebaiknya memperhatikan faktor-faktor yang dapat memicu timbulnya konflik yang dapat mengganggu kenyamanan saat bekerja. Bagi penelitian selanjutnya disarankan agar melakukan penelitian lebih lanjut dengan menambahkan variabel independen agar pengaruh antar variabel lebih besar, jumlah sampel dan menggunakan pemilihan metode penelitian yang lebih tepat.

Produktivitas tenaga kerja berpendidikan rendah sebagai dampak (outcome) pendidikan dalam industri padat karya di Kota Malang (sebuah studi kasus di pabrik rokok kretek "Sampoerna" Malang) / Dhiah Saptorini

 

Pengaruh persepsi konsumen tentang kredibilitas celebrity endorser pada iklan Pantene terhadap brand image produk (studi pada siswa-siswi pengguna produk Pantene di Madrasah Aliyah Negeri Rejotangan Kabupaten Tulungagung) / Dwi Khoirun Ni'mah N.

 

Kata kunci : kredibilitas celebrity endorser, brand image Dengan semakin berkembangnya arus informasi saat ini, strategi pemasaran yang kreatif dan menyentuh namun tetap efektif dan efisien mutlak diperlukan dalam upaya meningkatkan brand awareness dan merebut mind share masyarakat. Iklan merupakan salah satu kegiatan untuk dapat mencapai tujuan tersebut. Salah satu cara kreatif dalam beriklan adalah dengan menggunakan endorser. Penggunaan endorser diharapkan dapat memberikan asosiasi positif antara produk dengan endorser. Asosiasi tersebut secara sederhana dapat muncul dalam bentuk pemikiran atau citra tertentu yang dikaitkan pada suatu merek. Keterkaitan pada suatu merek akan lebih kuat apabila dilandasi pada banyak pengalaman untuk mengkomunikasikannya. Berbagai asosiasi yang diingat konsumen dapat dirangkai sehingga membentuk citra tentang merek di dalam benak konsumen. Penelitian ini merupakan penelitian asosiatif dan explanatory. Penelitian ini berusaha untuk menjelaskan besar pengaruh kredibilitas celebrity endorser yang terdiri dari keahlian (X1), kelayakan untuk dipercaya (X2), kemampuan untuk disukai (X3) terhadap brand image produk Pantene baik secara parsial maupun secara simultan. Populasi dalam penelitian ini adalah siswa-siswi Madrasah Aliyah Negeri Rejotangan Kabupaten Tulungagung yang menggunakan shampo Pantene. Sedangkan sampel dalam penelitian ini adalah 60 responden. Sampel diambil dengan menggunakan teknik propotional random sampling dan random sampling. Hasil penelitian ini menunjukkan bahwa : (1) terdapat pengaruh positif signifikan keahlian secara parsial terhadap brand image produk Pantene pada siswa-siswi Madrasah Aliyah Negeri Rejotangan Kabupaten Tulungagung, (2) terdapat pengaruh positif signifikan kelayakan untuk dipercaya secara parsial terhadap brand image produk Pantene pada siswa-siswi Madrasah Aliyah Negeri Rejotangan Kabupaten Tulungagung, (3) terdapat pengaruh positif signifikan kemampuan untuk disukai secara parsial terhadap brand image produk Pantene pada siswa-siswi Madrasah Aliyah Negeri Rejotangan Kabupaten Tulungagung, (4) terdapat pengaruh positif signifikan kredibilitas celebrity endorser (keahlian, kelayakan untuk dipercaya, kemampuan untuk disukai) secara simultan terhadap brand image produk Pantene pada siswa-siswi Madrasah Aliyah Negeri Rejotangan Kabupaten Tulungagung. Dengan demikian dapat disimpulkan bahwa kredibilitas celebrity endorser dapat mempengaruhi brand image produk baik secara parsial maupu secara simultan. Keahlian, kelayakan untuk dipercaya dan kemampuan untuk disukai mempengaruhi brand image produk Pantene pada siswa-siswi Madrasah Aliyah Negeri Rejotangan Kabupaten Tulungagung sebesar 50,2%, sedangkan sisanya 49,2% dipengaruhi oleh faktor-faktor lain diluar penelitian. Saran yang dapat diberikan berkenaan dengan temuan yang diperoleh selama pelaksanaan penelitian ini adalah (1) Direktur Periklanan Procter & Gamble Indonesia hendaknya tetap mempertahankan penggunaan Anggun C. Sasmi, karena selebriti tersebut memberikan pengaruh positif terhadap brand image produk. Di dalam pemilihan endorser Pantene selanjutnya hendaknya menambahkan penggunaan endorser laki-laki karena salah satu indikator dalam penelitian ini menunjukkan bahwa responden menganggap Pantene hanya ditujukan untuk kaum perempuan, (2) dalam penelitian selanjutnya disarankan agar objek penelitian yang diambil lebih baik, yaitu masyarakat umum dari berbagai golongan, usia, dan tempat penelitian yang lebih luas supaya data penelitian yang diperoleh lebih valid dan ruang lingkupnya lebih luas, (3) bagi peneliti selanjutnya disarankan untuk menambah jumlah variabel penelitian yang dapat mempengaruhi brand image produk selain variabel yang diteliti pada penelitian ini. Selain itu menyempurnakan kekurangan-kekurangan dalam penelitian ini dan dapat dijadikan dasar pertimbangan ilmiah bagi kesempurnaan yang ada.

Pengembangan media pembelajaran interaktif IPS kelas VI semester 1 pokok bahasan kenampakan alam dan keadaan sosial negara-negara tetangga di SDN Bandungrejosari I Malang / Mohammad Afif K.

 

Penerapan model pembelajaran problem based learning yang dipadukan dengan numbered heads together untuk meningkatkan hasil belajar siswa kelas VIII pada mata pelajaran IPS di SMP Negeri 7 Malang / Vivi Aprilia Safei

 

Kata Kunci : Problem Based Learning , Numbered Heads Together , hasil belajar, respon belajar Pendidikan merupakan sarana terpenting untuk mewujudkan kemajuan bangsa dan negara. Terkait dengan hal tersebut pendidikan di Indonesia masih memiliki mutu rendah jika dibandingkan dengan negara- negara maju. Permasalahan tersebut semakin diperparah dengan didominasinya proses pembelajaran yang menyatakan bahwa sebuah pengetahuan (knowledge) merupakan perangkat fakta- fakta yang harus dihafal. Metode pembelajaran mayoritas konvensional dengan teacher oriented di dalamnya. Oleh sebab itu dibutuhkan adanya sebuah strategi belajar mengajar baru dengan mengedepankan siswa aktif (student oriented) dan menjadikan pembelajaran menyenangkan untuk mendapatkan hasil yang berkualitas dengan cara pendekatan kontekstual. Salah satunya dengan model pembelajaran Problem Based Learning Yang Dipadukan Dengan Numbered Heads Together. Penelitian ini menggunakan penelitian tindakan kelas karena ada permasalahan yang harus disembuhkan dengan menggunakan penelitian tindakan kelas.Hal tersebut diperoleh dari data yang diperoleh sebelumnya.Penelitian ini menggunakan model pembelajaran Problem Based Learning Yang Dipadukan Dengan Numbered Heads Together karena disesuaikan dengan standar kompetensi dan kompetensi dasar .Tujuan dalam penelitian ini adalah untuk : (1) mendeskripsikan dan menganalisis penerapan model pembelajaran Problem Based Learning Yang Dipadukan Dengan Numbered Heads Together , (2) untuk mendeskripsikan penerapan model pembelajaran Problem Based Learning Yang Dipadukan Dengan Numbered Heads Together ,(3) untuk mendeskripsikan bagaimana respon siswa pada mata pelajaran ekonomi terhadap penerapan model pembelajaran Problem Based Learning Yang Dipadukan Dengan Numbered Heads Together Penelitian ini dilakukan di SMP Negeri 7 Malang. Analisis data dalam penelitian ini menggunakan metode deskriptif kualitatif yang bertujuan untuk mendapatkan gambaran secara jelas dan nyata tentang peristiwa yang tampak selama proses pembelajaran berlangsung. Peristiwa yang dimaksud adalah proses pelaksanaan langkah pembelajaran yang diterapkan dalam kelas dan hasil belajar serta respon belajar siswa pada mata pelajaran ekonomi dengan menggunakan model pembelajaran Problem Based Learning Yang Dipadukan Dengan Numbered Heads Together. Instrumen yang digunakan dalam penelitian ini adalah lembar observasi, lembar catatan lapangan, angket, dan pedoman wawancara. Hasil penelitian menunjukkan bahwa hasil belajar aspek kognitif siswa pada pre test meningkat sebesar 15,90 % pada siklus I menjadi 32,56 % pada siklus II. Sedangkan post test juga meningkat sebesar 85,71% pada siklus I menjadi 92,69 % pada siklus II. Data hasil belajar aspek afektif siswa juga menunjukkan hasil belajar yang meningkat. Hasil ini didasarkan pada nilai rata- rata sebesar 70,10% pada siklus I menjadi 96 % pada siklus II. Respon belajar siswa juga menjadi meningkat. Kesimpulan hasil penelitian ini adalah penerapan model pembelajaran Problem Based Learning Yang Dipadukan Dengan Numbered Heads Together dapat meningkatkan hasil belajar siswa dari aspek kognitif dan afektif, serta respon siswa dalam mengikuti mata pelajaran ekonomi. Saran dalam penelitian antara lain : (1) bagi masing- masing tingkat satuan pendidikan dan guru mata pelajaran ekonomi khususnya dalam mengkondisikan dalam penggunaan model pembelajaran ini, (2) penerapan model pembelajaran Problem Based Learning Yang Dipadukan Dengan Numbered Heads Together hendaknya disesuaikan dengan materi pelajaran, (3) bagi peneliti selanjutnya diharapkan adanya pengukuran tentang tujuan pembelajaran untuk mengukur keefektifan.

Pengaruh kepemimpinan transformasional terhadap kinerja melalui motivasi kerja (studi pada karyawan PT. PLN (Persero) Distribusi JAwa Timur APJ Malang) / Irma Setiawati

 

Kata Kunci: Kepemimpinan Transformasional, Motivasi Kerja, Kinerja Di dalam suatu organisasi maupun perusahaan, sumber daya manusia mempunyai peran yang sangat penting, karena sumber daya manusia merupakan penggerak di dalam organisasi, tanpa adanya sumber daya manusia maka aktivitas di dalam perusahaan bisa dikatakan tidak akan berjalan. Aktivitas yang dikerjakan oleh sumber daya yang ada diharapkan mampu meningkatkan kinerja yang telah menjadi tujuan perusahaan. Untuk itu salah satu upaya untuk meningkatkan kinerja pada setiap karyawan adalah dengan adanya kepemimpinan yang baik. Salah satu cara memimpin yang dapat digunakan adalah dengan kepemimpinan transformasional. Kepemimpinan transformasional adalah pemimpin yang memotivasi bawahan untuk melakukan sesuatu dan mencapai kinerja tertentu melebihi dari apa yang semula diharapkan/ diekspetasikan (Komardi, 2009:58). Penelitian ini bertujuan untuk mengetahui: 1) gambaran deskriptif kepemimpinan transformasional, motivasi kerja dan kinerja, 2) pengaruh kepemimpinan transformasional terhadap motivasi kerja, 3) pengaruh motivasi kerja terhadap kinerja, 4) pengaruh kepemimpinan transformasional terhadap kinerja, dan 5) pengaruh kepemimpinan transformasional terhadap kinerja melalui motivasi kerja. Kegiatan penelitian ini dilakukan di PT. PLN (Persero) Distribusi Jawa Timur APJ Malang. Untuk pengambilan datanya peneliti menggunakan kuesioner sebagai alat pengumpul data. Dari jumlah populasi 86 orang karyawan, peneliti mengambil 70 orang karyawan sebagai responden dengan menggunakan teknik pengambilan sampel Proportionate Stratified Random Sampling. Data yang peneliti peroleh kemudian peneliti uji menggunakan uji validitas dan reliabilitas serta dianalisis menggunakan analisis jalur (Path Analysis). Hasil penelitian menunjukkan bahwa: untuk kinerja karyawan diperoleh mean sebesar 51,57 dengan standar deviasi sebesar 5,45. Motivasi kerja dengan mean 104,53 dan standar deviasi 13,64. Dan kepemimpinan transformasional dengan mean sebesar 42,31 dan standar deviasi sebesar 5,87. Dari penelitian ini juga diketahui: 1) terdapat pengaruh positif yang signifikan antara kepemimpinan transformasional terhadap kinerja sebesar 0,489; 2) terdapat pengaruh positif yang signifikan antara motivasi kerja terhadap kinerja sebesar 0,551; 3) terdapat pengaruh positif yang signifikan antara kepemimpinan transformasional terhadap kinerja sebesar 0,267: dan 4) terdapat pengaruh positif yang signifikan antara kepemimpinan transformasional terhadap kinerja yang dimediatori variabel motivasi kerja sebesar 0,247 serta pengaruh total dari kepemimpinan transformasional terhadap kinerja sebesar 0,541.

Analisis peranan pendapatan asli daerah terhadap anggaran pendapatan dan belanja daerah di Kabupaten Bojonegoro (tahun analisis 2006-2009) / Eva Nurfitriana

 

Kata kunci: PAD, APBD Penelitian ini bertujuan untuk mengetahui kontribusi yang disumbangkan PAD terhadap APBD. Berdasarkan kebijakan otonomi daerah, diatur bahwa peralihan kewenangan untuk mengurus urusan pemerintahan daerah masing-masing yang terangkum dalam UU No. 32 Tahun 2004. Desentralisai disini mencakup pelayanan jasa pemerintahan bagi masyarakat maupun desentralisasi fiskal. Dengan adanya kebijakan tersebut, mau tidak mau pemerintah daerah harus mencari strategi untuk dapat meningkatkan pendapatan daerahnya terutama PADnya sehingga dapat memenuhi kebutuhan organisasi kepemerintahannya. PAD merupakan tolak ukur dari kemandirian suatu daerah. Proporsi penerimaan PAD Kabupaten Bojonegoro pada tahun 2006-2007 sudah cukup baik dengan rata-rata 7,23%, akan tetapi pertumbuhannya masih fluktuatif, contohnya proporsi PAD menurun dari 7,47% pada 2007 menjadi 6,58% pada tahun 2008. Melihat potensi Kabupaten Bojonegoro, dapat dipastikan Kabupaten Bojonegoro mampu meningkatkan penerimaan PAD secara stabil. Maka dari itu, diperlukan pengkajian mendalam terhadap potensi PAD di Kabupaten Bojonegoro. Jenis penelitian dalam skripsi ini adalah penelitian deskriptif dengan pendekatan kuantitatif. Kedudukan peneliti dalam penelitian kuantitatif merupakan perencana, pelaksana pengumpulan data, analis, penafsir data, dan pada akhirnya menjadi pelapor hasil penelitian. Sehingga peneliti adalah instrumen kunci penelitian. Jenis data dalam penelitian ini adalah data primer dan data sekunder. Teknik pengumpulan data dengan wawancara, observasi, dan dokumentasi. Analisis data berpedoman pada model analisis tipologi klassen. Sedangkan untuk mengetahui strategi kebijakan yang bisa diambil oleh pemerintah untuk meningkatkan PAD dengan menggunakan analisis SWOT. Secara umum PAD semakin meningkat setiap tahunnya, walaupun masih belum stabil. Peningkatan PAD untuk tahun 2007 cukup baik yaitu sebesar 8,81%, sedangkan untuk tahun 2008 hanya sebesar 3,9% dan untuk tahun 2009 semakin membaik yaitu 19,67%. Untuk kontribusi PAD masih tergolong rendah, karna pada pendanaan Kabupaten Bojonegoro, pemerintah pusat masih berperan besar, akan tetapi pertumbuhan perekonomian Bojonegoro semakin membaik, terlihat dari pertumbuhan ekonomi untuk tahun 2010 sebesar 12%. Strategi Peningkatan Pendapatan Asli daerah di Kabupaten Bojonegoro dapat dijabarkan beberapa tindakan intensifikasi untuk peningkatan pajak yaitu: meningkatkan pemungutan pajak, meningkatkan pengelolaan pajak daerah, menghidupkan pariwisata Bojonegoro, meningkatkan SDM pengelola PAD. Sedangkan untuk tindakan Ekstensifikasi untuk peningkatan Pajak yaitu: menciptakan sumber-sumber pajak baru, membaca kebutuhan masyarakat daerah. Untuk strategi peningkatan retribusi secara intensifikasi yaitu: meningkatkan pelayanan jasa, peran aktif pemda dalam mengawasi pengelolaan retribusi, memperbaiki sistem operasional pemungutan retribusi, perbaikan infrastruktur umum. Sedangkan untuk yang ekstensifikasi yaitu: mencipatakan pasar dengan menghidupkan entrepreneur.

Kajian terhadap pola seleksi berdasarkan keragaan pada pemuliaan kedelai tahan CPMMV dan berdaya hasil tinggi serta pemanfaatannya sebagai sumber belajar genetika / Asriah Nurdini Mardiyyaningsih

 

Program Studi Pendidikan Biologi, Program Pascasarjana, Universitas Negeri Malang. Pembimbing: (1) Prof. Dr. A. Duran Corebima, M.Pd., (2) Prof. Dr. Siti Zubaidah, M.Pd. Kata Kunci: pola seleksi, keragaan, ketahanan terhadap CPMMV, daya hasil Pola seleksi berdasarkan keragaan merupakan dasar pelaksanaan seleksi pada banyak program pemuliaan tanaman. Pola seleksi ini dilakukan dengan memilih tanaman berdasarkan fenotip karakter tertentu yang ingin dikembangkan dalam pemuliaan. Pada pemuliaan tanaman tahan CPMMV dan berdaya hasil tinggi, dilakukan pola seleksi berdasarkan keragaan daya hasil pada generasi F3 dengan parameter berat biji tanaman. Pola seleksi ini umumnya dihindari untuk dilaksanakan pada generasi awal pemuliaan karena keragaan daya hasil dikendalikan oleh multigen dan cenderung baru akan bersegregasi pada generasi lanjut sehingga sulit dijadikan dasar seleksi. Perlu dilakukan suatu kajian terhadap implikasi pelaksanaan pola seleksi berdasarkan keragaan daya hasil, khususnya pada pemuliaan kedelai tahan CPMMV dan berdaya hasil tinggi. Hasil kajian ini selanjutnya dimanfaatkan sebagai sumber belajar genetika. Penelitian ini merupakan penelitian deskriptif. Penelitian dilakukan pada total populasi seluruh kombinasi persilangan generasi F3 dan F4 tanaman kedelai yang dikembangkan pada pemuliaan kedelai tahan CPMMV dan berdaya hasil tinggi. Penelitian dilakukan untuk mengungkap status keragaan ketahanan terhadap CPMMV dan keragaan daya hasil tanaman kedelai pada generasi F3 dan F4 serta melihat perbaikan karakter keduanya. Perbaikan karakter ketahanan dikaji secara deskriptif dengan membandingkan kriteria ketahanan antar kombinasi persilangan pada generasi F3 dan F4. Perbaikan karakter daya hasil dikaji menggunakan perhitungan nilai kemajuan seleksi secara langsung, maupun melalui estimasi nilai heritabilitas. Dikaji pula kesinambungan urutan kombinasi persilangan terbaik antar generasi berdasarkan pola seleksi berdasarkan keragaan daya hasil. Selanjutnya disusun bahan ajar sebagai sumber belajar genetika. Hasil penelitian menunjukkan bahwa keragaan ketahanan terhadap CPMMV dan daya hasil pada F3 maupun F4 masih didominasi oleh karakter yang dikendalikan oleh gen dengan alel heterozigot sehingga persentase tanaman yang bersifat tahan maupun berdaya hasil tinggi pada kedua generasi tersebut masih rendah, meskipun terdapat kecenderungan adanya keragaan yang lebih baik pada F4. Berdasarkan pola seleksi berdasarkan keragaan daya hasil yang dilakukan pada F3, terdapat kecenderungan perbaikan ketahanan terhadap CPMMV berupa eliminasi tanaman yang bersifat rentan, dan kecenderungan perbaikan karakter daya hasil tanaman. Namun demikian, dalam penelitian ini tidak ditemukan urutan kombinasi persilangan terbaik yang sama antara generasi F3 dan F4. Dalam penelitian ini, hasil penelitian juga dapat dimanfaatkan sebagai sumber belajar genetika berupa modul pembelajaran genetika kuantitatif yang dikaitkan langsung dengan pola seleksi berdasarkan keragaan.

Kepemimpinan spiritual pada pesantren mahasiswa (studi multisitus pada Pesantren Mahasiswa Ulul Albab, Ulul Yaqin dan Ulul Hikam Malang) / Mokhamad Endri Julianto

 

Program Studi Manajemen Pendidikan, Program Pascasarjana Universitas Negeri Malang, Pembimbing; (I) Prof. Dr. H. Hendyat Soetopo, M.Pd, (II) Prof. H. Ahmad Sonhadji KH., Ph.D., dan (III) Prof. Dr. H. Ibrahim Bafadlal, M.Pd. Kata kunci : kepemimpinan spiritual, budaya organisasi, pesantren mahasiswa, nilai spiritual. Tipologi kepemimpinan dalam mengimplementasikan nilai-nilai spiritual untuk menciptakan budaya organisasi pesantren mahasiswa yang efektif. Tugas seorang pemimpin adalah mempengaruhi orang yang dipimpin untuk bersikap dan berperilaku sesuai dengan visi, misi, core values dan core belief organisasi. Pemimpin spiritual adalah pemimpin yang mempengaruhi orang yang dipimpin dengan cara mengilhamkan, mencerahkan, menyadarkan, membangkitkan, memampukan, dan memberdayakan lewat pendekatan spiritualitas atau nilai-nilai etis religius. Nilai-nilai etis religius inilah yang berperan sebagai mission-focused, vision-directed, philosophy-driven dan value- based institution. Ada tiga fokus terbagi dalam beberapa sub fukus yang perlu dijawab dalam penelitian ini yakni; (1) tipologi kepemimpinan terdiri dari ; (a) perspektif kepemimpinan spiritual, (b) spiritualitas kepemimpinan, (c) tipologi kepemim pinan spiritual. (2) tugas dan fungsi kepemimpinan spiritual dalam proses ; (a) pengambilan keputusan (b) pengendalian konflik, dan (c) pembangun tim (3) Sistem nilai spiritual kepemimpinan dalam budaya organisasi pesantren mahasiswa meliputi; (a) ragam nilai spiritual kepemimpinan dalam budaya organisasi pesantren mahasiswa, (b) sistem nilai kepemimpinan spiritual dalam budaya organisasi pesantren mahasiswa, (c) hambatan dan solusi penerapan nilai-nilai kepemimpinan spiritual di pesantren mahasiswa. Penelitian ini dilakukan di tiga pesantren mahasiswa, yaitu pesantren mahasiswa Ulul Albab, Ulul Yaqin dan Ulul Hikam di kota Malang Jawa Timur dengan menggunakan pendekatan kualitatif. Penelitian ini dirancang menggu nakan studi multi-situs. Teknik yang digunakan dalam mengumpulkan data meliputi (1) teknik pengamatan partisipatif ; (2) teknik wawancara mendalam; dan (3) teknik dokumentasi. Sedangkan informannya dipilih dengan menggunakan teknik purposive, yang dipadukan dengan teknik snowball sampling. Data yang terkumpul melalui berbagai teknik tersebut, diperiksa dan dilakukan reduksi data, penyajian data dan verifikasi data. Pengecekan keabsahan data dilakukan dengan menggunakan credibility (keterpercayaan), transferability (keteralihan), dependability (kebergantungan) dan confirmability (kepastian). Begitu data secara keseluruhan selesai diperiksa, data yang terkumpul dianalisis, dengan analisis dalam situs maupun analisis antar situs. Dari hasil penelitian diketahui bahwa; (1) Perspektif kepemimpinan spiritual pesantren mahasiswa merupakan organisasi yang beranggotakan para pimpinan struktural universitas dan atau yayasan serta beberapa kyai senior, kemudian disebut sebagai “majelis pengasuh” sebagai badan tertinggi di pesantren mahasiswa secara fungsional merupakan pengasuh pengurus harian dan sebagai pemimpin serta pengasuh santri mahasiswa. Segala bentuk pengadbiannya didasarkan pada pengemban amanah berdasarkan nilai-nilai spiritual keagamaan (Islam). (2) Spiritualitas kepemimpinan dalam majelis pengasuh teraktualisasi dalam mempengaruhi orang yang dipimpin dengan cara mengilhamkan, mencerahkan, menyadarkan, membangkitkan, memampukan, dan memberdayakan lewat pendekatan spiritualitas atau berperan sebagai mission-focused, vision-directed, philosophy-driven dan value- based institution. (3) Tipologi kepemimpinan berkecenderungan pada perilaku kepemimpinan kolegialpartisipatif –demokratis -religio spiritual bergantung kepada kapasitas peran dan otoritas yang dipenuhi majelis Pengasuh, serta kewenangan yang diberikan kepada pengurus harian. (4) Pengambilan keputusan majelis pengasuh dan atau pengurus harian dilakukan melalui musyawarah dan inisitif-inisiatif sebagai proses penetapan tujuan dan sosialisasi program dalam memperkaya gagasan dan keterlibatan semua pihak. (5) Penyelesaian konflik bersifat individual, mediasi, klarifikasi (tabayyun), proses ikrar dan perjanjian (tajdidun niyah), dan proses meja hijau (mahkamah), sebagai upaya penegakan syari’ah. (6) Pembangunan tim dilakukan melalui proses intensitas pertemuan dan pemerataan komunikasi di antara pengurus, pemanfaatan moment-moment, pelibatan para musrif dan musrifah di pesantren mahasiswa. (7) Ragam nilai kepemimpinan spiritual dalam budaya organisasi pesantren mahasiswa terdapat perbedaan skala nilai prioritas (scale priorities) pada warga pesantren mahasiswa. (8) Sistem nilai kepemimpinan spiritual dalam budaya organisasi pesantren mahasiswa terdapat kesepakatan nilai yang dianut bersama pada warga pesantren mahasiswa. (9) Terdapat beberapa hambatan dan solusi penyesaian dalam kepemimpinan spiritual di pesantren mahasiswa. Implikasi penelitian ini dapat mengilhami pola kepemimpinan pesantren mahasiswa yang selama ini dipimpin secara tradisional, kompensional dan individual minded. Menggunakan kepemimpinan spiritual dalam pesantren mahasiswa akan mengembalikan (khitoh) sebagai lembaga mulia (noble industry) berbasis nilai-nilai spiritual keagamaan (religio spiritual) yang mampu menciptakan budaya organisasi pesantren mahasiswa lebih efektif dan bermutu. Disarankan kepada majelis Pengasuh dan para pengurus harian pesantren mahasiswa hendaknya senantiasa tidak henti-hentinya mengembangkan profesionalisme, dan pesantren perlu kiranya semakin mendapat perhatian semua pihak (stake holders) untuk pengembangan dimasa mendatang sehingga menjadi lembaga pendidikan alternatif.

Analisis pengaruh suku bunga Bank Indonesia, kurs dollar dan jumlah uang beredar terhadap inflasi di Indonesia tahun 2000-2010 / Ryan Agustin

 

Kata kunci: suku bunga Bank Indonesia, kurs US Dollar, jumlah uang beredar, inflasi Inflasi merupakan suatu fenomena ekonomi yang mencerminkan kenaikan tingkat harga secara terus menerus dalam jangka waktu tertentu yang diikuti dengan penurunan nilai uang. Inflasi yang tinggi berpengaruh luas pada berbagai sektor kehidupan. Menurut teori kuantitas, jumlah uang beredar adalah sebab utama naiknya tingkat inflasi. Maka digunakan instrumen kebijakan moneter berupa suku bunga untuk mengendalikan tingkat inflasi. Selain itu, inflasi juga dapat ditimbulkan karena tekanan nilai tukar. Nilai tukar yang melemah juga dapat menaikkan laju inflasi Penelitian ini bertujuan untuk menganalisis pengaruh dari suku bunga Bank Indonesia (BI Rate), kurs US Dollar dan jumlah uang beredar terhadap inflasi di Indonesia tahun 2000-2010. Penelitian dirancang menggunakan metode kuantitatif dan termasuk dalam jenis penelitian korelasional. Data dalam penelitian ini merupakan data sekunder tentang suku bunga Bank Indonesia, kurs US Dollar, jumlah uang beredar dan inflasi dan diperoleh dari Statistik Ekonomi Keuangan Indonesia. Data yang terkumpul dengan cara dokumentasi dianalisis secara matematis dengan teknik regresi linier berganda. Hasil penelitian menunjukkan bahwa suku bunga Bank Indonesia memiliki pengaruh yang signifikan terhadap inflasi, kurs US Dollar memiliki pengaruh yang signifikan terhadap inflasi, jumlah uang beredar memiliki pengaruh yang signifikan terhadap inflasi. Secara simultan suku bunga Bank Indonesia, kurs US Dollar dan jumlah uang beredar berpengaruh signifikan terhadap inflasi di Indonesia. Saran penulis bahwa lembaga Universitas Negeri Malang hendaknya hasil penelitian ini dapat dijadikan sebagai bahan informasi, kepustakaan dan diharapkan dapat menjadi sumbangan bagi kepentingan atau perkembangan lembaga terutama dalam bidang kajian permasalahan ekonomi perbankan. Hasil penelitian ini dapat dijadikan referensi dan acuan kepada penelitian selanjutnya misalnya penelitian tentang inflasi pasca kenaikan harga BBM atau pengaruh implementasi kebijakan moneter terhadap inflasi. Hasil penelitian ini dapat dijadikan referensi dan juga rujukan bahan pertimbangan saat terjadi fluktuasi inflasi di Indonesia.

Pengaruh penerapan model pembelajaran cooperative integrated reading and composition (CIRC) terhadap hasil belajar IPS geografi siswa kelas VIII SMP Negeri 8 Malang tahun pelajaran 2010/2011 / Dini Afriani

 

Kata kunci: pembelajaran kooperatif, model pembelajaran Cooperative Integrated Reading And Composition (CIRC), hasil belajar. Kualitas pembelajaran dipengaruhi oleh berbagai faktor, salah satunya adalah proses pembelajaran yang diterapkan oleh guru di sekolah. Pelaksanaan pembelajaran saat ini perlunya perubahan paradigma pembelajaran dari yang berpusat pada guru(teacher centered) menjadi berpusat pada siswa (student centered). Pembelajaran yang didominasi oleh guru mengakibatkan siswa tidak banyak berperan dalam pembelajaran sehingga siswa cenderung pasif. Kurangnya kegiatan yang membutuhkan kerjasama antar siswa juga akan menyebabkan tumbuhnya sifat individual diantara mereka. Model pembelajaran Cooperative Integrated Reading And Composition (CIRC) berperan dalam meningkatkan kerjasama dan keaktifan siswa. CIRC dapat membantu siswa belajar memahami materi pelajaran melalui bacaan/wacana, artikel dan kliping dengan cara membaca, menganalisis dan memecahkan permasalahan yang diberikan oleh guru dan tidak bergantung pada teks tertentu disamping meningkatkan keaktifan siswa dalam kegiatan pembelajaran. Penelitian ini bertujuan mengetahui pengaruh penerapan model pembelajaran CIRC terhadap hasil belajar IPS Geografi siswa kelas VIII SMP Negeri 8 Malang khususnya pada Topik Permasalahan Kependudukan dan Upaya Penanggulangannya. Penelitian ini termasuk penelitian eksperimen semu (Quasi Eksperiment) dengan subjek penelitian dua kelas yaitu kelas VIII A sebagai kelas eksperimen dan kelas VIII D sebagai kelas kontrol. Instrumen penelitian berupa tes yaitu prates dan pascates. Teknik analisis yang digunakan adalah uji t tidak berpasangan yang diselesaikan dengan bantuan komputer program SPSS 16.0 for Windows. Hasil penelitian menunjukkan bahwa terdapat perbedaan yang signifikan antara nilai rata-rata kelas eksperimen dan kelas kontrol. Hasil analisis data menunjukkan bahwa rata-rata gain score siswa pada kelas eksperimen sebesar 28,30 sedangkan pada kelas kontrol sebesar 22,16 dengan nilai signifikansi sebesar 0,002 < α (0,05) sehingga dapat disimpulkan penerapan model CIRC berpengaruh terhadap hasil belajar IPS Geografi siswa. Saran yang diajukan untuk guru bidang studi IPS Geografi adalah menjadikan model CIRC sebagai alternatif model pembelajaran yang mampu meningkatkan hasil belajar siswa terutama pada Topik Permasalahan Kependudukan dan Upaya Penanggulangannya. Selanjutnya bagi peneliti lain agar dapat mengembangkan lebih lanjut pada materi lain dan menggunakan metode yang berbeda.

Pengelolaan sampah mandiri masyarakat perkotaan Surabaya (studi di Kecamatan Jambangan Kota Surabaya) / Dian Rizqi Ristyawati

 

Kata Kunci: pengelolaan sampah, efektivitas Menanggulangi masalah sampah yang ada khusnya di Kota besar seperti Surabaya, pemerintah kota beserta stakeholder terus berupaya dalam menyukseskan program pemberdayaan masyarakat untuk pengelolaan sampah mandiri dengan mengadakan penyuluhan akan pentingnya kebersihan lingkungan dengan menyelenggarakan lomba kebersihan yang diikuti oleh hampir seluruh merata di 163 Kel. yang ada di Surabaya, dengan menerapkan pengelolaan sampah mandiri dapat diketahui tingkat efektivitas pengelolaan sampah. Penelitian ini bertujuan untuk menjawab pertanyaan: (1) Bagaimana pengelolaan sampah mandiri yang dilakukan warga Kel. Karah dan Kel. Jambangan? (2) Problematika dalam pengelolaan sampah di Kel. Karah dan Kel. Jambangan? (3) Pengelolaan sampah mana yang paling efektif digunakan di Kel. Karah dan Kel. Jambangan?. Penelitian ini merupakan penelitian deskriptif dengan menggunakan metode survey. Pengambilan sampel menggunakan purposive sampling, dengan tehnik wawancara. Analisis data yang digunakan yaitu deskriptif untuk memperoleh data tentang bagaimana pengelolaan sampah mandiri yang dilakukan berdasarkan variabel yang ditemukan di lapangan. Hasil penelitian diperoleh data primer dan sekunder yaitu (1) pengelolaan sampah organik di Kel. Karah dan kel. Jambangan dikelolan secara individu dengan takakura dan secara komunal dengan menggunakan komposter dan hasil pengomposan dijual ke masyarakat umum dan DKP (Dinas Kebersihan dan Pertamanan). Pengelolaan sampah anorganik di Kel. Jambangan dibagi dalam beberapa kelompok yaitu pengepul, pencuci, pembuat planel dan penjahit. Hasil produk sampah anorganik dijual di galeri daur ulang sampah (2) Problematika yang ditemukan di lapangan dalam mengelola sampah mandiri adalah tidak semua warga mengelola sampah, kurangnya manajemen pengelolaan baik kaderisasi, bahan baku, tenaga kerja terampil dan penjualan (3) Pengelolaan sampah di Kel. Jambangan lebih efektif karena mengelola sampah organik dan anorganik dengan timbunan sampah rata rata selama tahun 2007-2010 di Kel. Karah mencapai 0,35 m3dan di Kel. karah mencapai 0,36 m3. Disimpulkan (1) perbedaan pengelolaan sampah mandiri yang dilakukan di Kel. Jambangan dan Kel. Karah terletak pada pengelolaan sampah anorganik (2) Pengelolaan sampah organik di Kel. Karah dan Jambangan memiliki problematika yang sama (3) pengelolaan sampah yang paling efektif yaitu di Kelurahan Jambangan walaupun mengalami angka penurunan sampah lebih rendah dibandingkan dengan Kel. Karah Adapun saran yang dapat diberikan (1) Pengelolaan sampah di Kelurahan Karah tidak hanya mengelola sampah organik melainkan sampah anorganik (2) Dibutuhkan aspek kelembagaan untuk membentuk struktur organisasi dalam menggerakkan, mengaktifkan dan mengarahkan sistem pengelolaan sampah dengan ruang lingkup bentuk institusi, pola organisasi personalia serta manajemen (3) Peran serta masyarakat dalam pengelolaan sampah sangat penting karena peran serta merupakan alat guna memperoleh informasi mengenai kondisi, kebutuhan dan sikap masyarakat setempat.

Penerapan pembelajaran kooperatif model jigsaw untuk meningkatkan hasil belajar geografi siswa kelas VIII semester 1 MTS Surya Buana Malang / Nofita Sari

 

Kata kunci: Pembelajaran Kooperatif Model JIGSAW, hasil belajar Berdasarkan observasi awal yang telah dilakukan di MTs Surya Buana Malang diketahui bahwa pembelajaran IPS masih didominasi oleh ceramah meskipun kadang-kadang terdapat variasi seperti tanya jawab dan diskusi. Akan tetapi pembelajaran tersebut dirasa kurang efektif melatih siswa dalam memecahkan masalah. Sehingga hasil belajar yang diperoleh siswa kurang memuaskan. Hal ini dapat dilihat pada hasil belajar kelas VIII B yang menunjukkan hanya 9 siswa yang nilainya telah memenuhi KKM sedangkan 15 siswa nilainya belum memenuhi KKM. Penelitian ini dilaksanakan di MTs Surya Buana Malang dengan subjek penelitian kelas VIII B yang berjumlah 24 siswa, pada materi permasalahan kependudukan dan upaya penanggulangannya. Penelitian ini termasuk dalam penelitian tindakan kelas yang terdiri dari dua siklus, masing-masing siklus terdiri dari dua pertemuan. Teknik pengumpulan data hasil belajar dengan menggunakan tes yang dilakukan setiap akhir siklus. Tujuan penelitian ini adalah untuk meningkatkan hasil belajar siswa dengan menerapkan model pembelajaran Jigsaw.. Hasil penelitian menunjukkan bahwa terdapat peningkatan nilai rata-rata kelas siswa sebelum dan setelah tindakan. Pada siklus I rata-rata hasil belajar siswa sebesar 68,08 dan ketuntasannya 67%. Jumlah ini meningkat dibandingkan dengan data awal (pra tindakan) yaitu 63,91 dengan nilai ketuntasanya 37%. Kemudian meningkat pada siklus II sebesar 80,08 dengan nilai ketuntasan 91%. Jumlah siswa yang sudah tuntas sebelum tindakan sebesar 9 siswa kemudian pada siklus I meningkat menjadi16 siswa dan pada siklus II meningkat menjadi 22 siswa. Berdasarkan uraian di atas dapat disimpulkan bahwa pembelajaran model Jigsaw dapat meningkatkan hasil belajar geografi siswa kelas VIII B MTs Surya Buana Malang.

Implementasi kurikulum tingkat satuan pendidikan (KTSP) pada pembelajaran ekonomi tahun ajaran 2010-2011 (studi kasus pada SMAI Al Maarif Singosari Kabupaten Malang) / Dika Listyaningtyas

 

Kata kunci: modal, usaha kecil Usaha kecil mempunyai kontribusi yang sangat besar dalam menopang perekonomian Indonesia. Bagian pentingnya yang berperan dalam keberlangsungan usaha kecil adalah modal. Modal sebagai komponen vital menentukan arah bagaimana suatu usaha bisa berkembang. Namun dalam kenyataan, permodalan pada usaha kecil masih sangat terbatas dan mengalami banyak permasalahan serta belum ada pengungkapan. Contoh indikasi adanya permasalahan permodalan pada usaha kecil adalah jika melihat Usaha kecil yang berjumlah lebih dari 90% dari jumlah keseluruhan usaha di Indonesia, namun dalam hal penghasilan yang diperoleh masih sangatlah kecil. Hal ini terjadi dikarenakan adanya permasalahan permodalan baik dari sisi relevansi, efektivitas, dan efisiensi sehingga penelitian ini berusaha menggali mengenai permasalaan permodalan pada usaha kecil. Penelitian ini dilakukan dengan pendekatan kuatitatif deskriptif dengan menggunakan metode pengumpulan data berupa observasi dan wawancara. Data awal yang dicari adalah prosentase modal dan alokasi penggunaan modal kemudian data yang diperoleh dideskripsikan secara rinci. Subyek penelitian adalah pelaku 8 sentra usaha unggulan kota Malang yaitu Sentra Keramik Dinoyo, Sentra Gerabah Penanggungan, Sentra Usaha Keripik Tempe Sanan Purwantoro, Sentra Usaha Mebel Tunjung Sekar, Sentra Usaha Rotan Bale Arjosari, Sentra Usaha Emping Jagung Arjosari, Sentra Usaha Kompor Merjosari, Sentra Usaha Saniter Karangbesuki. Hasil penelitian menunjukkan permodalan pada usaha kecil jumlahnya masih sangat kecil. Hal ini dikarenakan usaha kecil memiliki keterbatasan mengakses informasi dan adanya suku bunga yang tinggi. Dari sisi efektivitas, pemanfaatan modal masih sangat bergantung jumlah modal yang dimiliki dan keadaan pasar sedangkan di sisi efisiensi pemanfaatan modal masih terkendala besarnya modal yang dimiliki dan keterbatasan pengetahuan mengenai produksi. Berdasarkan hasil penelitian maka disarankan agar pemerintah memberikan kemudahan dalam memanfaatkan kredit untuk usaha kecil baik dari sisi sosialisasi kepada usaha kecil maupun tingkat suku bunga. Selain itu pemerintah juga diharapkan mampu mengontrol harga bahan baku dan bahan pembantu untuk produksi usaha kecil. Dari sisi efisiensi disarankan agar pemerintah sering melakukan pelatihan-pelatihan kepada pelaku usaha kecil mengenai alternatif produksi untuk meningkatkan efisisensi pada usaha kecil.

Pengaruh motivasi dan tata ruang kantor terhadap kinerja pegawai di Departemen Agama Bojonegoro / Laela Estuning Hidayati

 

Kata kunci: Motivasi, tata ruang kantor, kinerja pegawai Keberhasilan seseorang dalam suatu pekerjaan salah satunya ditentukan oleh motivasi atau dorongan untuk melakukan pekerjaan tersebut. Walaupun telah memilih individu dengan baik berdasarkan pada kemampuan alamiah, yang telah dilengkapi dengan latihan yang relevan dan sukses, disertakan dengan peralatan bantu yang tepat, faktor utama yang menentukan tingkat keberhasilannya adalah tingkat motivasinya. Di Indonesia, tata ruang kantor masih kurang mendapatkan perhatian. Seringkali terlihat adanya kantor-kantor besar yang tidak menata ruang kantor dengan baik terutama penempatan perabot, peralatan, dan alat-alat ketatausahaannya, sehingga semua proses kerja ketatausahaannya tidak berlangsung secara efisien. Namun, banyak kantor yang memiliki peralatan untuk proses bekerja yang lengkap, tetapi karena peralatan tersebut tidak ditata dengan baik, semua peralatan tersebut tidak dalam kondisi siap pakai. Karena itu, ruang kantor beserta kelengkapannya perlu ditata sedemikian rupa sehingga dapat dimanfaatkan secara efektif dan efisien. Penelitian ini dilakukan di Departemen Agama Bojonegoro. Penelitian ini bertujuan untuk mengetahui pengaruh motivasi, dan tata ruang kantor terhadap kinerja pegawai. Variabel bebas dalam penelitian ini terdiri dari motivasi (X1) dan Tata Ruang Kantor (X2) Sedangkan variable terikat dalam penelitian ini yaitu kinerja (Y). Jenis penelitian termasuk penelitian deskriptif korelasional. Populasi dalam penelitian ini adalah pegawai Departemen Agama Bojonegoro yang berjumlah 49 orang. Instrumen yang digunakan adalah angket/ kuesioner. Analisi yang digunakan adalah analisis regresi berganda dan menggunakan program SPSS versi 16,00 Hasil penelitian diketahui secara parsial variable motivasi (X1) memiliki pengaruh yang signifikan terhadap kinerja pegawai (Y) karena terbukti thitung > ttabel (1,803>1,645). Dan variable tata ruang kantor (X2) tidak berpengaruh yang signifikan terhadap kinerja pegawai (Y) karena terbukti thitung < ttabel (0,577 < 1,645). Hasil uji parsial diketahui bahwa variable yyang berpengaruh paling dominant terhadap kinerja pegawai adalah variabel motivasi (X1) karena memiliki thitung > ttabel. Secara simultan variable motivasi (X1) dan tata ruang kantor (X2) memiliki pengaruh yang signifikan terhadap kinerja pegawai (Y) karena terbukti thitung > ttabel (1,711 >1,645). Kinerja pegawai dipengaruhi oleh variable bebas yaitu motivasi pegawai (X1) dan tata ruang kantor (X2) sebesar 37,6% dan sisanya 62,3% dipengaruhi oleh variable-variabel lain yang tidak dijelaskan dalam penelitian ini. Berdasarkan studi pengamatan ini dapat disarankan kepada kepala Departemen Agama agar selalu melakukan pembinaan terhadap kemampuan professional pegawai agar melakukan tugas dan fungsinya sesuai dengan pedoman yang ada sehingga dapat meningkatkan kinerjanya, kepada pegawai Departemen Agama agar melakukan pengembangan profesionalitas yang antara lain berupa mengikuti pendidikan dan atau pelatihan, pembinaan yang teratur, dan kepada peneliti lain diharapkan dapat mengembangkan penelitian tentang variabel-variabel yang mempengaruhi kinerja yang tidak dijelaskan dalam penelitian ini.

Penstabil tegangan DC pada pembangkit listrik tenaga angin dengan metode converter push-pull / Syaifudin Zuhri

 

Kata kunci : Converter Puss-Pull, Regulator Peralatan penstabil yang mengandung rangkaian pembangkit pulsa, converter dan regulator. Dalam aplikasinya dapat di gunakan sebagai pengisian baterai yang akhirnya bisa di gunakan dalam peralatan yang membutuhkan tegangan DC dan mampu di gunakan sebagai energy alternatife untuk memenuhi kebutuhan peralatan rumah tangga di daerah-daerah yang belum ada persediaan listrik. Prinsip kerja penstabil di mulai dari sumber tegangan DC dari generator yang di gerakkan oleh turbin. Permasalahan yang muncul dari pembangkit ini adalah kecepatan angin yang tidak menentu. Daya listrik yang dihasilkan generator juga tidak menentu. Tegangan yang di hasilkan oleh generator akan di hubungkan ke rangkaian converter untuk di step up menggunakan transformator. Sebelum tegangan dari generator masuk ke rangkaian converter, terlebih dahulu melewati mosfet yang di aktifkan oleh pembangkit pulsa melalui kaki gate untuk di kuatkan arusnya dari drain ke source. Transformator mengubah tegangan maksimal dari 15 volt ke 30 volt DC. Sedangkan untuk menjaga kestabilan tegangan pada proses pengisian baterai di perlukan regulator. Pada tugas akhir ini membahas mengenai bagaimana membuat pulse width modulation dengan IC TL494, Bagaimana membuat rangkaian penaik tegangan menggunakan metode converter push-pull, Bagaimana membuat rangkaian regulator supaya dapat digunakan dalam pengisian aki dan digunakan untuk menjalankan inverter. Dari hasil penelitian yang dilakukan dapat diperoleh penstabilan tegangan 15 volt jika tegangan sebelum masuk regulator sebesar 16,5 volt. Tegangan keluaran penstabilan yang sebesar 13 volt mendekati tegangan yang diharapkan untuk melakukan pengisian baterai yaitu sebesar 12 volt. Simpulan dari perancangan ini adalah perencanaan Penstabil Tegangan DC Pada Pembangkit Listrik Tenaga Angin Dengan Metode Converter Push-Pull ini yang berfungsi untuk membangkitkan tenaga listrik dari generator yang di gerakan oleh angin. Tegangan keluaran dari generator ini belum stabil sehingga digunakan penaikan tegangan dan regulator untuk menstabilkan tegangan. IC LM 7815 digunakan sebagai regulator dengan penambahan transistor untuk penguatan arus.

Perbaikan faktor daya menggunakan kapasitor pada motor induksi 3 fasa / Khamidah Kusniah

 

Kata Kunci: faktor daya, kapasitor, otomatisasi Faktor daya atau cos φ yang rendah dalam industri merupakan kerugian yang harus diminimalkan. Faktor daya tersebut diakibatkan oleh pemakaian beban-beban induktif seperti lampu TL dan motor listrik. Kerugian yang ditimbulkan antara lain bertambahnya biaya listrik dan biaya instalasi yang harus disediakan, serta pemanasan pada motor induksi. Alat simulasi perbaikan faktor daya yang dapat menyesuaikan jumlah kapasitor yang dipakai untuk memperbaiki faktor daya tersebut. Adapun sistem yang dibangun pada alat otomatis ini adalah: (1) Pengukuran faktor daya; (2) Mikrokontroler dengan masukan jumlah daya reaktif dan keluaran berupa driver relay yang akan menghubungkan dan memutuskan kapasitor yang dibutuhkan dalam perbaikan faktor daya. Permasalahan yang diangkat adalah bagaimana merancang alat perbaikan faktor daya pada beban-beban induktif secara otomatis dan bagaimana rangkaian untuk kontrol otomatis perbaikan faktor daya,dan Untuk mewujudkan alat perbaikan faktor daya tersebut, digunakan metode pengembangan dengan menggunakan langkah sebagai berikut: (1) Studi literatur, (2) Perencanaan dasar, (3) Perancangan alat, dan (4) Pengujian alat. Alat yang dibuat ini mampu memperbaiki faktor daya dari 0,2 menjadi 0,93. Sehingga dapat dikatakan hasil tersebut sudah layak digunakan untuk memperbaiki faktor daya. Dari analisa hasil pengujian dan pembahasan dapat ditarik kesimpulan: (1) Dalam memperbaiki cos φ dari beban induktif digunakan kapasitor yang dirangkai paralel. Untuk mengatur penyambungan kapasitor dapat digunakan mikrokontroler yang mana input dari mikrokontroler tersebut dari sensor beda fasa.

Perbandingan hasil belajar siswa yang diajar dengan metode mengajar kelompok dan metode demonstrasi pada pelajaran menjahit celana pria kelas XI Busana di SMK Negeri 3 Malang / Nidya Sasando

 

Kata kunci: Metode Mengajar Kelompok, Metode Demonstrasi, Hasil Belajar. Metode mengajar kelompok memberikan tekanan utama pada peningkatan kemampuan individu sebagai anggota kelompok. Metode ini dapat ditempuh guru dengan jalan: membagi kelas dalam beberapa kelompok dan memberi kesempatan untuk belajar perorangan dan berkelompok kecil, dalam hal ini guru perlu mencegah terjadinya perilaku siswa sebagi parasit belajar, dan ketidakmampuan kerja kelompok. Metode demonstrasi merupakan metode pembanding yang cara penyajian pelajaran tersebut dengan cara meragakan atau mempertunjukkan kepada siswa suatu proses, situasi, atau benda tertentu yang sedang dipelajari, baik sebenarnya ataupun tiruan, yang sering disertai dengan penjelasan lisan. Penilaian hasil belajar pada Sekolah Menengah Kejuruan menggunakan sistem pembelajaran berbasis kompetensi, pada dasarnya merupakan proses penentuan untuk memastikan siswa apakah sudah kompeten atau belum. Hasil belajar diperoleh dari penggunaan metode mengajar kelompok dan metode demonstrasi. Penelitian ini dilakukan untuk mengetahui perbedaan metode mengajar kelompok dan demonstrasi pada pelajaran menjahit celana pria yang dilakukan di SMK Negeri 3 Malang, tanggal 24 Agustus 2009 - 25 Desember 2009. Populasi diambil dari siswa kelas XI Busana. Sampel diambil dari siswa kelas XI Busana 1 dan 2. Sedangkan sumber data yang dipilih adalah guru pengajar dari masing-masing kelas. Pengumpulan data dilakukan dengan observasi dan nilai praktik. Variabel bebas: metode mengajar kelompok dan metode demonstrasi (X), Variabel terikat: hasil belajar siswa pada pelajaran menjahit celana pria (Y). Hasil penelitian pengunaan metode kelompok: (1) Kecermatan penguasaan prilaku dalam menjahit saku passepoille 93%,saku sisi 93%, tutup tarik 93%, ban pinggang 93%. (2) Kecepatan unjuk kerja dalam menjahit saku pasepoille 64%, saku sisi 93%, tutup tarik 93% dan ban pinggang 68%. (3) Kesesuaian dengan prosedur dalam menjahit saku pasepoille 89%, saku sisi 89%, tutup tarik 93% dan ban pinggang 68%. (4) Kualitas unjuk kerja dalam menjahit saku pasepoille 93%, saku sisi 93%, tutup tarik 89% dan ban pinggang 89%. (5) Tingkat alih belajar dalam menjahit saku pasepoille 89%, saku sisi 93%, tutup tarik 96% dan ban pinggang 68%. (6) Tingkat retensi dalam menjahit saku pasepoille 89%, saku sisi 93%, tutup tarik 89% dan ban pinggang 68%. Hasil penelitian pengunaan metode demonstrasi: (1) Kecermatan penguasaan prilaku dalam menjahit saku pasepoille 93%, saku sisi 89%, tutup tarik 89% dan ban pinggang 89%. (2) Kecepatan unjuk kerja dalam menjahit saku pasepoille 46%, saku sisi 57%, tutup tarik 89% dan ban pinggang 68%. (3) Kesesuaian dengan prosedur dalam menjahit saku pasepoille 89%, saku sisi 89%, tutup tarik 89% dan ban pinggang 68%. (4) Kualitas unjuk kerja dalam menjahit saku pasepoille 46%, saku sisi 57%, tutup tarik 89% dan ban pinggang 68%. (5) Tingkat alih belajar dalam menjahit saku pasepoille 89%, saku sisi 46%, tutup tarik 89% dan ban pinggang 68%. (6) Tingkat retensi dalam menjahit saku pasepoille 89%, saku sisi 89%, tutup tarik 89% dan ban pinggang 68%. Berdasarkan hasil penelitian dapat disimpulkan bahwa siswa yang diajar dengan menggunakan metode kelompok mempunyai nilai yang lebih tinggi dibandingkan dengan siswa yang diajar dengan menggunakan metode demonstrasi pada pelajaran celana pria di kelas XI Busana SMK Negeri 3 Malang. Penelitian ini tentunya memiliki banyak kekurangan, alangkah baiknya bila peneliti lain mempunyai waktu, lokasi dan faktor lain yang mendukung akan lebih baik apabila pengambilan populasi dan sampel dilakukan dari beberapa sekolah yang melaksanakan metode mengajar kelompok dan demonstrasi pada pelajaran produktif. Penelitian selanjutnya supaya lebih sempurna lagi sebaiknya untuk membuktikan bahwa perbandingan metode mengajar kelompok dan metode demonstrasi perlu dikembangkan intrumen lain seperti angket untuk menggali data tersebut. Sebaiknya dalam memilih metode mengajar pada pelajaran produktif lebih bervariasi. Berdasarkan penelitian ini supaya lebih efektif sebaiknya mengembangkan penggunaan metode kelompok dalam pelajaran produktif di Sekolah Kejuruan.

Keefektifan model pembelajaran problem based learning (PBL) terhadap pemahaman konsep fisika siswa kelas X SMA Negeri 2 Kediri / Achmad Yoesoef

 

Kata kunci: pemahaman konsep, problem based learning Penelitian ini bertujuan untuk menguji: (1) perbedaan pemahaman konsep fisika antara siswa yang belajar menggunakan model PBL dengan siswa yang belajar menggunakan model tradisional, (2) keefektifan pembelajaran model PBL terhadap pembelajaran model tradisional dalam peningkatan pemahaman konsep fisika Penelitian ini menggunakan rancangan eksperimen semu (quasi experimental) pretest-posttest control group design. Subjek penelitian ini adalah siswa kelas X SMA Negeri 2 Kediri tahun pelajaran 2009/2010. Sampel penelitian adalah dua kelas yang ditetapkan berdasarkan teknik simple random sampling. Kelas pertama belajar dengan model PBL. Kelas kedua belajar dengan model tradisional. Data pemahaman konsep dikumpulkan dengan 22 butir tes DIRECT versi 1,0 yang dimodifikasi. Data dianalisis dengan statistik ANAVA dan uji Scheffé. Pengujian hipotesis nol dilakukan pada taraf signifikansi 5%. Hasil penelitian menunjukkan temuan-temuan sebagai berikut. (1) terdapat perbedaan yang signifikan pemahaman konsep fisika antara siswa yang belajar menggunakan model PBL dengan siswa yang belajar menggunakan model tradisional. Pemahaman konsep fisika pada kelas PBL lebih tinggi daripada kelas tradisional (2) pembelajaran model PBL lebih efektif daripada model tradisional dalam peningkatan pemahaman konsep fisika

Penerapan metode eksperimen dan bermain peran untuk meningkatkan kualitas proses dan prestasi belajar fisika siswa kelas VII-H SMPN 4 Kediri / Atik Joedanarni

 

Kata kunci: Keaktifan, Prestasi Belajar, Metode Eksperimen, Bermain Peran Berdasarkan observasi di SMPN 4 Kediri kususnya di kelas VII-H menunjukkan guru masih menekankan pemberian materi pelajaran saja, kurang memperhatikan proses bagaimana informasi tersebut diterima oleh siswa. Strategi pembelajaran yang digunakan guru tidak bervariasi, bahkan monoton sehingga siswa belum aktif dalam pembelajaran. Oleh karena itu peneliti ingin mengembangkan belajar dengan situasi yang memungkinkan siswa pada saat KBM berlangsung keaktifan siswa, keterampilan berpikir dan keterampilan motoriknya meningkat sehingga hasilnya bisa maksimum.Tujuan dari penelitian ini untuk mengetahui peningkatan keaktifan dan prestasi belajar pada konsep Gerak dan Kalor menerapkan metode eksperimen dan bermain peran. Jenis penelitian ini adalah Penelitian Tindakan Kelas (PTK). Instrumen yang digunakan adalah lembar observasi yang terdiri dari: (1) keterlaksanaan pembelajaran, (2) aktivitas siswa, dan (3) penilaian aspek psikomotorik. Kemampuan kognitif diukur menggunakan tes yang dilaksanakan pada setiap akhir siklus. Hasil penelitian menunjukkan adanya peningkatan pelaksanaan pembelajaran yakni pada siklus I mencapai 70,75% dan pada siklus II mencapai 971,38%, keaktifan siswa meningkat pada siklus I mencapai 75,00% dan pada siklus II mencapai 90,00% demikian juga prestasi belajar siswa yakni pada siklus I dicapai ketutasan belajar siswa sebesar 55,00% dan pada siklus II mencapai 86,00% atau dengan rata-rata pada siklus I mencapai 70,21 dan pada siklus II mencapai 83,00. Dari hasil penelitian ini dapat disimpulkan bahwa pembelajaran dengan metode eksperimen dan bermain peran dapat meningkatkan mutu pembelajaran di kelas khususnya pada konsep Gerak dan Kalor. Pembelajaran dengan metode eksperimen dan bermain peran memiliki kelebihan (1) meningkatkan keaktifan, kreativitas, realistik dan menyenangkan, (2) dapat meningkatkan rasa percaya diri pada siswa dan melatih siswa untuk berani mengemukakan pendapatnya. Kekurangannya adalah (1) memerlukan waktu yang relatif banyak dibandingkan dengan model ceramah (2) memerlukan perencanaan dan persiapan yang matang (3) memerlukan tingkat kreatifitas guru yang tinggi. Berdasarkan hasil penelitian ini dapat disarankan, (1) Guru bidang studi Fisika sejenis dapat menggunakan dan menerapkan pembelajaran dengan metode eksperimen dan bermain peran untuk meningkatkan keaktifan dan prestasi belajar siswa. (2) Guru bidang studi IPA dapat mempelajari dan menerapkan tahap demi tahap metode eksperimen dan bermain peran sehingga hasil belajar siswa dapat meningkat secara optimum.

Penerapan strategi pair check untuk meningkatkan kemampuan menulis siswa kelas XI MAN Malang I / Laila Mufidah

 

Kata kunci: menulis, strategi pair check, MAN Penerapan strategi pair check untuk meningkatkan kemampuan menulis ber tujuan agar siswa memiliki kemampuan dalam menuangkan ide, pikiran, pengalaman, dan pendapatnya dalam bahasa Arab dengan benar. Dengan strategi pair check memungkinkan bagi siswa untuk saling bertukar pendapat dan saling memberikan saran tentang bahan tulisan yang akan ditulis. Pelaksanaan pembelajaran menulis yang sudah dilakukan di kelas XI masih berkisar pada mengurutkan kata menjadi kalimat yang padu ataupun mentransleterasi tulisan Latin ke Arab. Sehingga siswa tidak terbiasa untuk mengungkapkan ide, gagasan dan pendapatnya dalam bentuk bahasa Arab. Untuk menyempurnakan strategi pembelajaran menulis yang dilakukan oleh guru, peneliti mencoba strategi pair check. Dalam strategi pair check terdapat diskusi yang dilakukan dalam kelompok kecil/saling berpasangan. Dengan diterapkannya strategi pair check, diharapkan mampu meningkatkan kemampuan siswa XI IPS 3 MAN Malang I dalam pembelajaran menulis. Tujuan penelitian ini adalah untuk mendeskripsikan penerapan strategi pair check dalam pembelajaran bahasa Arab dan mendeskripsikan peningkatan kemampuan menulis bahasa Arab dengan menerapkan strategi pair check. Penelitian ini adalah penelitian tindakan kelas yang berupa siklus-siklus. Setiap siklus terdiri atas empat tahap kegiatan yaitu: perencanaan, pelaksanaan tindakan, pengamatan, dan refleksi. Dalam penelitian ini peneliti bertindak sebagai perencana, pelaksana, dan pelapor penelitian dalam pelaksanaan. Instrument yang digunakan yaitu (1) pedoman observasi, (2) pedoman wawancara, (3) angket, (4) tes. Data penelitian ini berupa informasi tentang pelaksanaan pembelajaran bahasa Arab dengan strategi pair check dan proses peningkatan kemampuan menulis bahasa Arab dengan menerapkan strategi pair check. Kedua hal tersebut direkam dalam catatan lapangan berupa proses tindakan yang terjadi pada masing-masing siklus dan hasil tulisan siswa pada tiap siklus. Pelaksanaan pembelajaran menulis bahasa Arab dengan strategi pair check dilakukan melalui proses menulis melalui tahapan berikut. Tahap pra menulis, kegiatan yang dilakukan diantaranya: membangkitkan semangat menulis siswa dan memberikan stimulus, menentukan kelompok belajar dalam hal ini yaitu pasangan siswa, menentukan topik yang akan ditulis, menyampaikan langkah-langkah menulis, mengajak siswa untuk mulai menulis. Tahap saat menulis kegiatan yang dilakukan yaitu memberikan contoh kalimat dan meminta siswa untuk memperhatikan aspek-aspek penulisan kalimat diantaranya struktur kalimat, penggunanan pilihan kata, i ketepatan tulisan, kerapian tulisan dan pengembangan kalimat. Tahap pasca menulis, hal-hal yang dilakukan yakni merevisi dan memberikan hasil revisinya. Proses peningkatan kemampuan menulis ditandai dengan semakin aktifnya siswa dalam kegiatan pembelajaran dan berkurangnya kendala-kendala yang dialami siswa dari siklus I sampai siklus III yang terekam dalam catatan lapangan dan meningkatnya kemampuan menulis siswa yang tampak pada hasil tulisan siswa. Secara keseluruhan rata-rata hasil siklus I adalah 54,9 sedangkan pada siklus II 68,1 dan pada siklus III 70,2 . Dengan demikian, dapat disimpulkan bahwa penerapan strategi pair check dapat meningkatkan kemampuan menulis siswa. Mengingat manfaat yang dapat diperoleh siswa, maka disarankan bagi guru untuk bisa menerapkan strategi pair check sebagai salah satu strategi yang dapat digunakan untuk meningkatkan ketrampilan menulis siswa dan berusaha meningkatkan profesionalisme guru dan kualitas pembelajaran bahasa Arab dengan mengembangkan media dan strategi menulis agar tidak hanya terpacu pada lembar kerja siswa. Bagi peneliti selanjutnya diharapkan meneliti kemampuan berbahasa Arab yang lain dengan menggunakan strategi pair check.

Studi variasi morfologi vegetatif tumbuhan tergolong mimosaceae di lingkungan sekitar kampus Universitas Negeri Malang / Metha Dimas Chalistyani

 

Kata kunci: Variasi Morfologi, Mimosaceae, Kampus Universitas Negeri Malang. Observasi yang dilakukan di lingkungan Universitas Negeri Malang terhadap beberapa tumbuhan Mimosaceae pada bulan Pebruari 2010 ditemukan variasi penampakan morfologi. Tujuan dari penelitian ini adalah untuk mengetahui ciri morfologi vegetatif dan variasi morfologi vegetatif pada tumbuhan tergolong Mimosaceae. Metode penelitian yang digunakan adalah deskriptif dengan pengambilan secara acak tumbuhan tergolong Mimosaceae di lingkungan sekitar kampus Universitas Negeri Malang. Variasi karakter morfologi terdapat pada organ batang dan daun. Batang memperlihatkan variasi karakter morfologi pada perawakan yaitu pohon, semak tegak atau berbaring; permukaan batang berlentisel pecah-pecah, tidak pecah-pecah, atau berduri dan berambut; pada umumnya tidak berbanir, tetapi ada yang berbanir kecil atau besar; arah tumbuh batang tegak atau berbaring; arah tumbuh cabang condong ke atas atau berbaring; warna daun muda hijau atau coklat; permukaan rakis gundul, berambut halus, berambut kasar; duri pada rakis ada atau tidak; kelenjar rakis tidak ada, pada tiap buku, atau pada bagian pangkal saja; warna kelenjar hijau atau hitam; bentuk kelenjar berupa tonjolan atau cekungan; tipe stipula berupa lembaran, sisik, atau duri; warna stipula hijau, coklat, hijau kecoklatan, atau putih; stipula rontok atau tidak; bentuk anak daun jorong, memanjang, atau lanset; ujung anak daun runcing atau meruncing, tekstur anak daun herbaseus atau seperti kertas; tekstur permukaan atas anak daun suram, gundul, atau mengkilat; tekstur permukaan bawah anak daun gundul atau berbulu; tulang anak daun rapat atau renggang. Penelitian ini menunjukkan bahwa terdapat variasi karakter morfologi organ vegetatif pada tumbuhan tergolong Mimosaceae di lingkungan sekitar kampus Universitas Negeri Malang. Variasi karakter morfologi lebih banyak ditemukan pada organ daun. Disarankan penelitian selanjutnya untuk melihat variasi karakter organ generatif agar dapat mengenal jenis suatu tumbuhan dengan lebih akurat. Karakter organ generatif sangat penting untuk pengenalan jenis suatu tumbuhan.

Inovasi wingko berbahan dasar tepung gadung / Erni Gustami

 

Kata Kunci: Wingko, tepung gadung, kelapa parut Wingko gadung adalah produk wingko yang dibuat dengan menggunakan tepung gadung dan kelapa parut sebagai bahan utama. Penggunaan kelapa parut bertujuan untuk mengetahui perbedaan dan tingkat kesukaan yang meliputi rasa, tekstur, aroma, dan warna dari wingko gadung tersebut. Penelitian ini adalah penelitian eksperimen yaitu membuat wingko berbahan dasar tepung gadung dengan persentase yang berbeda serta penambahan kelapa parut dalam jumlah yang berbeda. Analisis data yang digunakan dalam penelitian ini adalah Analisis Sidik Ragam, apabila ada perbedaan yang signifikan, dilanjutkan uji Duncan’s Multiple Range Test. Hasil penelitian uji pembedaan pasangan menunjukkan rasa wingko berbahan dasar tepung gadung 70% dengan penambahan kelapa parut 30% lebih baik dari kontrol dengan derajat perbedaan yaitu berbeda sedikit dengan kontrol (wingko dari tepung beras ketan) skor rerata (5,69). Perbedaan tekstur wingko berbahan dasar tepung gadung 70% dengan penambahan kelapa parut 30% lebih baik dari kontrol dengan derajat perbedaan yaitu berbeda sedikit dengan kontrol (wingko dari tepung beras ketan) skor rerata (5,99). Perbedaan aroma wingko berbahan dasar tepung gadung 70% dengan penambahan kelapa parut 30% lebih baik dari kontrol dengan derajat perbedaan yaitu berbeda sedikit dengan kontrol (wingko dari tepung beras ketan) skor rerata (5,96). Perbedaan warna wingko berbahan dasar tepung gadung 70% dengan penambahan kelapa parut 30% lebih baik dari kontrol dengan derajat perbedaan yaitu berbeda sedikit dengan kontrol (wingko dari tepung beras ketan) skor rerata (5,87). Hasil uji pembedaan pasangan wingko gadung dengan wingko menunjukkan bahwa semakin tinggi persentase penambahan kelapa parut dalam pembuatan wingko gadung memberikan hasil berupa rasa wingko yang terlalu manis, tekstur mudah rapuh, aroma terlalu harum, dan warna coklat kehitaman. Hasil uji hedonik wingko gadung menunjukkan tingkat kesukaan wingko berbahan dasar tepung gadung 70% dengan penambahan kelapa parut 30% untuk rasa memperoleh skor rerata (3,54), tekstur memperoleh skor rerata (3,54), aroma memperoleh skor rerata (3,63), dan warna memperoleh skor rerata (3,66) yaitu panelis memilih kriteria suka. Wingko dengan 70% tepung gadung dan penambahan kelapa parut 30% merupakan wingko yang menghasilkan rasa, tekstur, aroma, dan warna yang berbeda sedikit dengan kontrol (wingko dari tepung beras ketan) dan disukai oleh panelis. Kesimpulan penelitian ini adalah penambahan kelapa parut dalam pembuatan wingko gadung akan menghasilkan produk yang hampir sama dengan wingko yang terbuat dari tepung beras ketan. Saran bagi peneliti selanjutnya adalah perlu diteliti mengenai daya simpan produk inovasi dari tepung gadung dan pemanfaatan tepung gadung sebagai produk olahan yang berdaya jual tinggi.

Upaya penanaman rasa cinta budaya Indonesia melalui kelas Paguyuban Peminat Seni Tradisi (PPST), kelas VIII PPST di SMP Negeri 4 Kota Malang / Ririn Sussanti

 

Sussanti, Ririn. 2013. Upaya Penanaman Rasa Cinta Budaya Indonesia Melalui Kelas Paguyuban Peminat Seni Tradisi (PPST), Kelas VIII PPST Di SMPN 4 Kota Malang Skripsi, Program Studi Pendidikan Pancasila dan Kewarganegaraan, Jurusan Hukum dan Kewarganegaraan, Fakultas Ilmu Sosial, Universitas Negeri Malang. Pembimbing: (I) Drs. H. Suparman A W, SH, M. Hum (II) Drs. I Kt Diara Astawa, SH, M. Si Kata Kunci : Upaya Penanaman Rasa Cinta Budaya Indonesia, Paguyuban Peminat Seni Tradisi (PPST) Kesatuan budaya lokal yang dimiliki Indonesia merupakan budaya bangsa yang mewakili identitas negara Indonesia. Budaya lokal harus tetap dijaga serta dilestarikan dengan baik agar budaya bangsa tetap terjaga kelestariannya. Kebudayaan lokal yang merupakan akar dari kebudayaan nasional perlu dijaga dilestarikan pada generasi muda terutama siswa yang sedang mengalami kegiatan belajar di sekolahnya. Untuk merealisasi hal itu pemerintah daerah provinsi Jawa Timur memiliki program membentuk kelas Paguyuban Peminat Seni Tradisi (PPST) di sekolah, salah satunya adalah pengadaan kelas PPST di SMPN 4 Kota Malang. Penelitian ini bertujuan untuk menggambarkan: (1) Untuk mengetahui latar belakang dibentuknya kelas Paguyuban Peminat Seni Tradisi (PPST) di SMP Negeri 4 Kota Malang; (2) Untuk mengetahui program kegiatan yang dilaksanakan di dalam kelas Paguyuban Peminat Seni tradisi (PPST) di SMP Negeri 4 Kota Malang; (3) Untuk mengetahui pelaksanaan kegiatan di dalam kelas Paguyuban Peminat Seni Tradisi (PPST) di SMP Negeri 4 Kota Malang; (4) Untuk mengetahui nilai-nilai rasa cinta budaya Indonesia apa saja yang terkandung di dalam kelas Paguyuban Peminat Seni Tradisi (PPST) di SMP Negeri 4 Kota Malang; (5) Untuk mengetahui bagaimana upaya penanaman rasa cinta budaya Indonesia melalui kelas Paguyuban Peminat Seni Tradisi (PPST) di SMP Negeri 4 Kota Malang; (6) Untuk mengetahui apa saja kendala yang dihadapi dalam upaya penanaman rasa cinta budaya Indonesia di dalam kelas Paguyuban Peminat Seni Tradisi (PPST) di SMP Negeri 4 Kota Malang. Metode yang digunakan dalam penelitian ini adalah menggunakan pendekatan kualitatif dengan jenis penelitian deskriptif. Teknik pengumpulan data yang digunakan adalah observasi, wawancara, dan dokumentasi. Observasi untuk mengamati langsung segala macam gejala sosial yang ada baik proses, situasi, kondisi, dan aktivitas dari yang diteliti oleh peneliti. Dokumentasi untuk mendokumentasikan sebagai bukti peneliti dan pendukung hasil penelitian. Hasil dari temuan penelitian ini diperoleh kesimpulan sebagai berikut: (1) Kelas Paguyuban Peminat Seni Tradisi (PPST) di SMPN 4 Kota Malang, pada awalnya merupakan program yang dimiliki oleh Pemerintah Provinsi Jawa Timur bertujuan untuk menjaga dan mengembangkan kelestarian kebudayaan kesenian tradisional daerah yang merupakan akar dari kebudayaan nasional Indonesia, melalui pengadaan kelas PPST ini juga dapat mengembangkan dan menyalurkan ii bakat yang dimiliki dalam diri siswa, terutama bidang kesenian, sehingga para siswa dapat memetik makna dari setiap kegiatan pembelajaran yang diberikan; (2) Kegiatan yang dilaksanakan di dalam kelas PPST masuk dalam bidang studi pelajaran muatan lokal yang di dalamnya terdapat pembelajaran seni tari, seni karawitan, dan seni pertunjukan, setiap kegiatan pembelajaran yang dilakukan memiliki agenda kegiatan yang jelas, jadi dalam pelaksanaannya lebih teratur dan dapat dipertanggung jawabkan; (3) Pelaksanaan kegiatan pembelajaran dalam kelas Paguyuban Peminat Seni Tradisi (PPST) di SMPN 4 Kota Malang dilaksanakan dalam 2 waktu kegiatan, yaitu waktu kegiatan intrakurikuler dan waktu kegiatan ekstrakurikuler, waktu intrakurikuler dilaksanakan pada hari selasa dan kamis yang dimulai pada pukul 13.00 sampai pukul 15.00, sedangkan waktu ekstrakurikuler dilaksanakan pada hari senin, rabu, jumat, dan sabtu yang dimulai pukul 13.00 sampai dengan pukul 15.00, kegiatan intrakurikuler PPST ini masuk pada jam efektif sekolah, sedangkan waktu ekstrakurikuler berada diluar jam efektif sekolah. Kegiatan di dalam kelas PPST ini rutin dilakukan agar pembelajaran yang dilakukan didalam kelas PPST dapat berjalan maksimal; (4) Nilai-nilai rasa cinta budaya yang terkandung pada kegiatan pembelajaran kelas Paguyuban Peminat Seni Tradisi (PPST) di SMPN 4 Kota Malang antara lain sebagai berikut: (a) Nilai persatuan tercermin dari bentuk kegiatan yang mempelajari berbagai macam kebudayaan tradisional daerah Indonesia;(b) Nilai keindahan tampak pada saat pembelajaran seni tari, seni karawitan, dan seni pertunjukan; (c) Nilai ekonomis yang tercermin di dalam kegiatan kelas PPST adalah berupa hadiah yang didapatkan apabila berhasil memenangkan suatu lomba dan keahlian yang didapat dapat digunakan untuk mendapatkan uang; (d) Nilai ketenangan yang ada tergambar pada perasaan senang yang dirasakan siswa ketika melakukan berbagai kegiatan di dalam kelas PPST; (e) Nilai historis yang ada tercermin dalam bentuk kegiatannya yang merupakan kesenian tradisional daerah yang merupakan warisan dari leluhur terdahulu; (f) Nilai manfaat tercermin pada keahlian yang didapat dari hasil kegiatan kelas PPST tersebut dapat bermanfaat dalam kehidupan sehari-hari; (g) Nilai religius nampak pada saat siswa melakukan doa bersama sebelum dan sesudah kegiatan pembelajaran; (5) Upaya penanaman rasa cinta budaya dalam pelaksanaan kegiatan pembelajaran pada kelas Paguyuban Peminat Seni Tradisi (PPST) di SMPN 4 Kota Malang adalah melalui materi kegiatan pembelajaran yang diberikan kepada para siswa PPST; (6) Dalam pelaksanaan upaya penanaman di dalam kelas Paguyuban Peminat Seni Tradisi (PPST) terdapat beberapa kendala yang dihadapi, antara lain: (a) Kemauan yang dimiliki anak dalam masuk kelas Paguyuban Peminat Seni Tradisi (PPST), hal ini sangat berpengaruh ketika seorang anak mempelajari materi yang diberikan di dalam kelas PPST; (b) Kurikulum yang belum jelas pada pengadaan kelas PPST, karena selama ini pengadaan kelas PPST hanya sebatas mengacu pada program dari pemerintah provinsi jawa timur; (c) Pendanaan dalam pengadaan fasilitasfasilitas untuk menunjang kegiatan pembelajaran di dalam kelas PPST

Pengaruh strategi pembelajaran kooperatif students teams achievement division (STAD) dipadu dengan cooperative script terhadap kemampuan berpikir kritis dan hasil belajar kognitif siswa kelas VIII SMPN 2 Singosari Malang / Lukmanul Hakim

 

Kata kunci: kooperatif STAD dipadu dengan Cooperative Script, kemampuan berpikir kritis, dan hasil belajar kognitif. Menurut hasil observasi diketahui bahwa siswa di SMPN 2 Singosari pada pembelajaran biologi menunjukkan bahwa kemampuan berpikir kritis dan hasil belajar kognitif siswa masih tergolong rendah. Temuan tersebut dapat dilihat dari hasil ulangan harian siswa. Oleh karena itu guru biologi di SMPN 2 Singosari hanya memberikan soal tes dengan tingkatan kognitif C3. Sehingga guru belum pernah menggembangkan soal tes dengan tingkat kognitif C4 sampai dengan C6. Hal ini menunjukkan bahwa tingkat kognitif siswa masih tergolong rendah pada jenjang pendidikan SMP. Penelitian ini bertujuan untuk mengetahui pengaruh Strategi Pembelajaran kooperatif STAD dipadu dengan Cooperative Script terhadap kemampuan berpikir kritis dan hasil belajar kognitif siswa Kelas VIII SMPN 2 Singosari. Jenis penelitian yaitu Penelitian quasi eksperimen atau eksperimen semu. Variabel bebas dalam penelitian ini adalah Strategi Pembelajaran yang terdiri atas dua macam yaitu Strategi pembelajaran kooperatif STAD dipadu dengan Cooperative Script dan Multi Strategi. Variabel terikat dalam penelitian ini adalah: a) kemampuan berpikir kritis, b) hasil belajar kognitif. Dalam penelitian ini metode pengumpulan data melalui hasil pre tes yang dilakukan sebelum penerapan strategi pembelajaran dan pos tes yang dilakukan setelah penerapan strategi pembelajaran yang diukur dengan menggunakan rubrik untuk mengetahui kemampuan berpikir kritis, dan hasil belajar kognitif menggunakan pemahaman konsep. Hasil penelitian menunjukkan Strategi pembelajaran kooperatif STAD dipadu dengan Cooperative Script mampu meningkatkan kemampuan berpikir kritis siswa sebesar 434,75% lebih tinggi dari multi strategi. Strategi pembelajaran kooperatif STAD dipadu dengan Cooperative Script mampu meningkatkan hasil belajar kognitif siswa sebesar 183,22% lebih tinggi dari multi strategi. Berdasarkan hasil penelitian ini dapat disimpulkan bahwa strategi pembelajaran kooperatif STAD dipadu dengan Cooperative Script dapat meningkatkan kemampuan berpikir siswa, dan hasil belajar kognitif siswa pada matapelajaran Biologi. Untuk itu disarankan kepada guru Biologi agar menerapkan strategi pembelajaran kooperatif STAD dipadu dengan Cooperative Script karena telah terbukti dapat meningkatkan kemampuan berpikir siswa, dan hasil belajar kognitif siswa.

Pengembangan model latihan pertahanan satu lawan satu (man to man defense) pada tim putra ekstrakurikuler bolabasket di SMA Negeri 1 Kepanjen / Iwan Saifullah

 

Kata kunci: Pengembangan, Model Latihan Pertahanan Satu Lawan Satu Man To Man Defense. Pertahanan man to man defense adalah pertahanan satu lawan satu yang mengharuskan setiap pemain bertahan menjaga atau menempel satu pemain penyerang sesuai dengan posisinya dalam permainan bolabasket. Pemain bertahan harus membayangi pemain penyerang kemana pun dia bergerak di lapangan, selalu berada antara ring basket dan pemain penyerang. Agar siswa dapat melakukan teknik pertahanan man to man defense, siswa membutuhkan suatu model latihan yang mudah dimengerti dan mudah dilakukan oleh siswa. Dengan model yang mudah dimengerti dan mudah dilakukan, maka diharapkan siswa dapat lebih cepat dan bisa melakukan teknik pertahanan man to man defense dengan baik dan benar. Tujuan dari penelitian pengembangan model latihan pertahanan man to man defense ini adalah untuk membantu dan mempermudah siswa-siswa dalam mempercepat penguasaan keterampilan teknik pertahanan bolabasket. Prosedur pengembangan model latihan pertahanan man to man defense melalui tahap-tahap sebagai berikut: 1) Analisis Kebutuhan; 2) Pembuatan Produk Awal; 3) Revisi Produk Awal; 4) Uji Coba Produk; 5) Revisi Produk Uji Coba; 6) Uji Coba Lapangan; 7) Revisi Produk Akhir; 8) Hasil Akhir. Lokasi penelitian dilakukan di SMA Negeri 1 Kepanjen. Sasaran pebelajar adalah siswa ekstrakurikuler bolabasket putra SMA Negeri 1 Kepanjen. Subjek uji coba terdiri dari 1) Tinjauan ahli, terdiri dari 3 orang ahli yaitu 1 ahli pengembangan dan 2 ahli kepelatihan bolabasket; 2) Uji kelompok kecil adalah menggunakan 12 siswa ekstrakurikuler bolabasket SMA Negeri 1 Kepanjen; 3) Uji lapangan yang terdiri dari 20 siswa ekstrakurikuler bolabasket SMA Negeri 1 Kepanjen. Dari pengembangan dan prosedur yang telah dilakukan, maka diperoleh hasil pengembangan model latihan pertahanan man to man defense pada tim putra ekstrakurikuler bolabasket di SMA Negeri 1 Kepanjen.. Berdasarkan hasil penelitian ini, disarankan untuk diujicobakan pada sekolah-sekolah atau klub-klub bolabasket yang lebih banyak sehingga dapat diketahui keefektivitasan produk. Penelitian ini hanya sebatas suatu model latihan, jadi lebih baiknya apabila ada suatu pengembangan VCD untuk memperjelas produk ini.

Pengembangan CD interaktif pembelajaran keramik teknik cetak tekan untuk mahasiswa penempuh mata kuliah keramik dasar Program Studi Pendidikan Seni Rupa Universitas Negeri Malang / Makhyudin Khanif Kurniawan

 

Kata Kunci : CD interaktif, pengembangan, keramik teknik cetak. Multimedia interaktif adalah media yang dapat berinteraksi secara langsung dengan pembelajar, karena interaktif memiliki komunikasi yang bersifat dua arah. Sedangkan CD Interaktif dapat diartikan sebagai CD yang menyimpan atau memiliki aplikasi interaktif atau multimedia di dalamnya. Pengembang melihat kondisi saat proses pembelajaran keramik teknik cetak tekan di Pendidikan Seni Rupa Universitas Negeri Malang, materi yang diberikan kepada mahasiswa masih menggunakan metode klasikal. Karena keramik teknik cetak tekan merupakan mata kuliah yang berhubungan praktis atau praktek kerja, sehingga tidak memungkinkan bagi mahasiswa untuk menggunakan media cetak dan mendengarkan demo dari pengajar saja untuk memahami materinya. Tujuan dari penelitian pengembangan ini adalah untuk menghasilkan media pembelajaran CD Interaktif Pembelajaran Keramik Teknik Cetak Tekan Untuk Mahasiswa Penempuh Mata Kuliah Keramik Dasar Program Studi Pendidikan Seni Rupa Universitas Negeri Malang. Kegiatan penelitian pengembangan ini meliputi tujuh tahap dengan menggunakan model pengembangan Borg & Gall yang telah diadaptasi dan disesuaikan dengan lapangan, yaitu meliputi: 1) penelitian pendahuluan, 2) perencanaan; 3) pengembangan draf produk awal; 4) uji coba perorangan; 5) revisi produk utama; 6) uji coba kelompok kecil ; 7) revisi produk operasional. Instrumen pengumpulan data menggunakan angket untuk ahli media dan ahli materi. Sedangkan metode analisis data menggunakan metode deskripsi dengan prosentase. Berdasarkan hasil analisis ahli ,CD Interaktif ini dinyatakan valid dengan hasil perhitungan 64% oleh ahli media dan 77% oleh ahli materi, sedangkan hasil dari perhitungan analisis dari uji mahasiswa individual diperoleh 77% dan uji mahasiswa kelompok kecil 75%. Saran yang diajukan, hendaknya agar dilakukan uji coba secara berulang-ulang pada subyek yang lebih besar dan diharapkan dapat disosialisasikan kepada lembaga pendidikan terkait. Penelitian hanya terbatas pada pengembangan produk, diharapkan ada penelitian selanjutnya untuk menguji tingkat efektifitas dari produk CD Interaktif keramik teknik cetak tekan yang dikembangkan. Produk yang dihasilkan diharapkan dapat bermanfaat bagi pengguna produk.

Perancangan modul bagi instruktur pelatihan desain ornamen keramik di Desa Precet Kabupaten Blitar / Roby Dwi Choiri Andhi

 

Kata Kunci : perancangan, modul, pelatihan, ornamen keramik, Blitar. Kerajinan keramik telah lama berkembang sebagai tumpuan hidup pengrajin di desa Precet Kabupaten Blitar yang sekarang ini mengalami kesulitan dalam hal pemasaran karena mereka sulit mengembangkan motif hias keramiknya karena minimnya pengetahuan dibidang desain ornamen. Dari permasalahan itu modul bagi instruktur pelatihan desain ornamen keramik ini dirancang guna memberikan solusi atas masalah tersebut, dengan mengacu pada kebutuhan yang ada dilapangan modul ini berisikan uraian materi, gambar ilustrasi materi, dan tugas latihan yang relevan dengan tujuan pelatihan. Pemilihan media modul dapat digunakan sebagai acuan instruktur pelatihan untuk meyampaikan atau mentrasformasikan ilmu mengenai desain ornamen. Tujuan dari penelitian perancangan ini adalah untuk menghasilkan media pelatihan berupa “Modul Pelatihan Bagi Instruktur Pelatihan Desain Ornamen Keramik di Desa Precet Kabupaten Blitar” yang digunakan untuk memberikan solusi atas masalah yang ada pada pengrajin di desa tersebut. Kegiatan penelitan perancangan meliputi enam tahap yang mengunakan model perancangan Dick dan Carey (1991) yang telah diadaptasi dan disesuaikan dengan lapangan, yaitu: 1) Melakukan penelitian pendahuluan dan pengumpulan informasi, 2) Perencanaan, 3) Perancangan Produk Awal, 4) Merumuskan evaluasi formatif, 5) Uji evaluasi ahli, 6) Revisi produk. Instrumen pengumpulan data uji ahli menggunakan angket untuk ahli media dan ahli materi. Sedangkan metode analisis data menggunakan metode deskripsi dengan prosentase. Berdasakan hasil uji evaluasi ahli media didapat kriteria keberhasilan cukup baik dengan persentase 75,4% dan hasil uji ahli materi didapat criteria keberhasilan baik dengan persentase 94%. Berdasarkan hasil uji coba diatas, produk perancagan ini sudah baik dan dapat digunakan dalam pelatihan. Saran yang diajukan, hendaknya produk media Modul pelatihan mandiri desain ornamen keramik yang dihasilkan dilanjutkan dengan uji coba operasional sehingga diperoleh produk yang dapat digunakan sebagai media pelatihan yang lebih baik.

Pengaruh kondisi septictank, kedalaman sumur, dan kepadatan pemukiman terhadap kualitas air tanah di Kecamatan Sukorejo Kota Blitar / Charis Nurul Hidayat

 

Kata kunci:kondisiseptictank,kepadatanpemukiman, kedalamansumur, kualitas air tanah Masalahkualitas air di Kota Blitarsemakinmenurundanmemprihatinkan. Hal inidikarenakantinggirendahnyakualitas air tanahkhususnya yang ada di kotaditentukanolehkondisifisiklokasipenelitiandankondisisosialpenduduksetempat . Permasalahan air tanah di KecamatanSukorejo Kota Blitarmenjadipermasalahanutamabagipemerintahdanpendudukdalamhalrendahnya kualitas air tanah. Dua kelurahan di Kecamatan Sukorejo masuk dalam kawasan merah dengan kualitas sanitasi yang buruk dan penduduk yang berpindah menggunakan air PDAM di sekitar Pasar Legi. Penelitianinibertujuanuntuk(1) Mengkajikualitas air tanah di KecamatanSukorejoapakahmemenuhistandarbakumutu air minumgolongan A menurut PERMENKES RI No. 492/MENKES/PER/IV/2010, (2) Mendiskripsikanpengaruhkondisi septictankterhadapkualitas air tanah di KecamatanSukorejo, dan (3) Mendiskripsikanpengaruhkedalaman sumur dan kepadatan pemukimanterhadapkualitas air tanah di KecamatanSukorejo. Jenispenelitianiniadalahdeskriptifkomparatifdenganpendekatankualitatif.M etodeyang digunakandalampenelitianiniyaitumetodesurvei.Analisistabulasisilangdigunakanu ntukmenganalisispengaruhkondisi septictank, kedalaman sumur, dan kepadatan pemukiman di Kecamatan Sukorejo terhadap kualitas air tanah, sedangkananalisisdeskriptifkomparatifdigunakanuntukmembandingkan data kualitas air tanahdenganbakumutu air golongan A. Hasilpenelitianmenunjukkanbahwakualitas air tanahdangkal di KecamatanSukorejomelebihiambangbatasstandarbakumutu air minumgolongan A PERMENKES RI No. 492/MENKES/PER/IV/2010. Keseluruhansampel air sumur yang diambilmenunjukkanpencemaran coli tinjadan pH yang bersifatasam.Perbedaannilaikualitas air tanahditentukanolehfaktorkepadatan pemukiman, faktor kondisi septictank dan kedalaman.Jadi, seluruhsampel air tanahdi KecamatanSukorejo Kota Blitartidakamanuntukdikonsumsisecaralangsung,sangatperluuntukmelakukanpeng olahanterlebihdahulu demi kesehatandanhigienitas air minum.Kata kunci:kondisiseptictank,kepadatanpemukiman, kedalamansumur, kualitas air tanah Masalahkualitas air di Kota Blitarsemakinmenurundanmemprihatinkan. Hal inidikarenakantinggirendahnyakualitas air tanahkhususnya yang ada di kotaditentukanolehkondisifisiklokasipenelitiandankondisisosialpenduduksetempat . Permasalahan air tanah di KecamatanSukorejo Kota Blitarmenjadipermasalahanutamabagipemerintahdanpendudukdalamhalrendahnya kualitas air tanah. Dua kelurahan di Kecamatan Sukorejo masuk dalam kawasan merah dengan kualitas sanitasi yang buruk dan penduduk yang berpindah menggunakan air PDAM di sekitar Pasar Legi. Penelitianinibertujuanuntuk(1) Mengkajikualitas air tanah di KecamatanSukorejoapakahmemenuhistandarbakumutu air minumgolongan A menurut PERMENKES RI No. 492/MENKES/PER/IV/2010, (2) Mendiskripsikanpengaruhkondisi septictankterhadapkualitas air tanah di KecamatanSukorejo, dan (3) Mendiskripsikanpengaruhkedalaman sumur dan kepadatan pemukimanterhadapkualitas air tanah di KecamatanSukorejo. Jenispenelitianiniadalahdeskriptifkomparatifdenganpendekatankualitatif.M etodeyang digunakandalampenelitianiniyaitumetodesurvei.Analisistabulasisilangdigunakanu ntukmenganalisispengaruhkondisi septictank, kedalaman sumur, dan kepadatan pemukiman di Kecamatan Sukorejo terhadap kualitas air tanah, sedangkananalisisdeskriptifkomparatifdigunakanuntukmembandingkan data kualitas air tanahdenganbakumutu air golongan A. Hasilpenelitianmenunjukkanbahwakualitas air tanahdangkal di KecamatanSukorejomelebihiambangbatasstandarbakumutu air minumgolongan A PERMENKES RI No. 492/MENKES/PER/IV/2010. Keseluruhansampel air sumur yang diambilmenunjukkanpencemaran coli tinjadan pH yang bersifatasam.Perbedaannilaikualitas air tanahditentukanolehfaktorkepadatan pemukiman, faktor kondisi septictank dan kedalaman.Jadi, seluruhsampel air tanahdi KecamatanSukorejo Kota Blitartidakamanuntukdikonsumsisecaralangsung,sangatperluuntukmelakukanpeng olahanterlebihdahulu demi kesehatandanhigienitas air minum.

Meningkatkan motivasi dan prestasi belajar siswa kelas VIII SMPN 2 Pare melalui pembelajaran berbantuan Macromedia flash 8 / Kristien Endah Riwayati

 

Program Pascasarjana, Program Studi Pendidikan Dasar, Universitas negeri Malang. Pembimbing I: Dr. Muhardjito, M.S dan Pembimbing II: Prof. Dr.Siti Zubaidah, M.Pd Kata Kunci : Motivasi belajar, prestasi belajar, pembelajaran berbantuan macromedia flash 8 Motivasi dan prestasi belajar siswa SMPN 2 Pare masih rendah, hal ini disebabkan karena siswa kurang aktif berperan di dalam proses pembelajaran. Guru sudah semaksimal mungkin berupaya memberikan materi pelajaran fisika dengan berbagai cara, menggunakan metode power point sudah dilakukan setiap kali pertemuan. Mengatasi permasalahan ini perlu diadakan penelitian untuk menemukan metode pembelajaran yang dapat meningkatkan motivasi dan prestasi belajar siswa. Rancangan penelitian yang digunakan adalah penelitian tindakan kelas, ya¬itu penelitian pendidikan yang dilaksanakan di dalam kelas dengan tujuan untuk memperbaiki atau meningkatkan kualitas pembelajaran. Penelitian ini terdiri atas dua siklus, masing-masing siklus melalui tahap perencanaan tindakan, pelaksana¬an tin¬dakan, observasi dan refleksi, dan pada setiap siklus terdiri dari empat kali per¬temuan. Metode yang digunakan adalah pembelajaran berbantuan macromedia flash 8 dengan mem¬be¬rikan media animasinya, memakai sintaks pembelajaran lang¬sung yang sudah dimodifikasi. Subjek yang dijadikan objek penelitian adalah sis¬wa kelas VIII-A SMP Negeri 2 Pare sebanyak 24 siswa. Hasil penelitian menunjukkan bahwa setelah penerapan pembelajaran berbantuan macromedia flash 8 ternyata prestasi belajar siswa kelas VIII-A mengalami kenaikan skor rata-rata dari siklus I ke siklus II dari 78,25 menjadi 85,75. Berarti telah terjadi peningkatan prestasi belajar siswa setelah penerapan pembelajaran berban¬tuan macromedia flash 8. Berdasarkan hasil angket motivasi dan observasi motivasi belajar siswa yang didasarkan atas aspek per¬hatian, keterkaitan, keyakinan dan kepuasan dapat dinyatakan bahwa motivasi belajar siswa mengalami peningkatan dimulai dari tahap awal, akhir siklus I dan akhir siklus II. Ternyata bahwa penerapan media pem¬be¬lajaran dengan menggu¬nakan macromedia flash 8 dapat meningkatkan mo¬tivasi belajar siswa kelas VIII-A SMPN 2 Pare. Bagi guru bidang studi Fisika disarankan untuk menerapkan model pem¬be¬lajaran berbantuan macromedia flash 8 ini pada materi dengan karakteristik yang sesuai misalnya cahaya. Bagi peneliti lain yang ingin menerapkan model pembela¬jaran yang sama hendaknya bukan hanya meneliti aspek motivasi dan prestasi belajar saja tetapi dapat meneliti aspek afektif dan psikomotor siswa.

Analisis pengaruh jumlah dana pihak ketiga (DPK) dan rasio tingkat performing loans (NPL), terhadap jumlah kredit yang disalurkan PT. Bank Rakyat Indonesia (Persero), TMK. periode 2000-2009 / Fanikmatul Irmah

 

Kata kunci : Sumber Dana Pihak Ketiga (DPK), rasio tingkat NPL dan kredit yang disalurkan. Kredit merupakan komponen asset terbesar sekaligus merupakan sumber risiko bagi BRI. Disamping itu juga, kredit yang disalurkan mempunyai peranan yang besar terhadap pertumbuhan ekonomi. Kemampuan menyalurkan kredit oleh PT. BRI dipengaruhi berbagai hal yang dapat ditinjau dari sisi internal dan eksternal bank. Dari sisi internal bank terutama dipengaruhi oleh kemampuan bank di dalam menghimpun dana masyarakat dan pengendalian kredit bermasalah dengan berbagai kebijakan yang ada. Pada penelitian ini kemampuan penyaluran kredit dilihat dari sisi internal karena lebih dapat dikontrol dibanding sisi eksternal. Metode penelitian yang digunakan adalah metode deskriptif kuantitatif yang menganalisis, menjelaskan dan menggambarkan suatu masalah sebagai mana adanya sehingga merupakan pengungkapan suatu fakta dari data dokumen yang berkaitan dengan objek yang di teliti. Dengan menggunakan data sekunder berupa laporan tahunan PT.BRI (Persero), Tbk mulai tahun 2000-2009, penelitian ini menganalisis pengaruh variabel indipenden, yaitu jumlah Dana Pihak Ketiga (DPK) dan Rasio Tingkat Non Performing Loan (NPL), terhadap variabel dependen, yaitu penyaluran kredit di wilayah kerja BRI nasional. Yang bertujuan untuk mengetahui pengaruh keseimbangan variabel DPK dan NPL dalam jangka pendek dan jangka panjang terhadap penyaluran kredit BRI. Selain itu penelitian ini mengimplementasikan kebijakan-kebijakan yang perlu ditindaklanjuti untuk pengembangan kinerja keuangan PT.BRI. Adapun teknik analisis yang digunakan adalah regresi linear dengan model ECM (Error Corection Model) pada program EVIEWS 5.1. Hasil estimasi ECM menunjukkan bahwa dalam jangka pendek DPK tidak berpengaruh signifikan terhadap penyaluran kredit. Hal ini dikarenakan bank lebih suka menanamkan dananya dalam bentuk SBI (Sertifikat Bank Indonesia) karena lebih aman dari pada kredit yang rawan macet. sedangkan dalam jangka panjang DPK memiliki pengaruh yang signifikan terhadap penyaluran kredit. Kemudian Variabel NPL baik dalam jangka pendek maupun jangka panjang berpengaruh negatif dan signifikan terhadap penyaluran kredit. Pulihnya kepercayaan masyarakat terhadap sistem perbankan dengan adanya program penjaminan pemerintah telah mendorong kenaikan Dana Pihak Ketiga (DPK). Selain itu, peningkatan pengelolaan resiko dan penerapan good corporate governance melalui pelaksanaan peraturan dan prosedur kerja yang selalu disempurnakan mampu mengatasi permasalahan modal dan non performing loan (NPLs) yang berhasil ditekan telah meningkatkan kemampuan BRI dalam menyalurkan kredit kepada sektor UMKM pada khususnya. Sikap hati-hati mendorong BRI memaksimalkan peran unit kerja kepatuhan, manajemen risiko serta audit intern.

Penerapan metode iqro' pada pembelajaran calistung (studi kasus kelompok belajar Merpati di Dusun Wonosari Kecamatan Kaliwates Kabupaten Jember) / Irliana Faiqotul Himmah

 

Kata- kata Kunci : metode iqro’, program keaksaraan fungsional, pendidikan luar sekolah Penelitian ini difokuskan pada pertanyaan dasar, bagaimana penerapan Metode Iqro’ pada pembelajaran membaca, menulis, berhitung (calistung)?. Untuk itu, penelitian ini bertujuan mendiskripsikan tentang: 1) rasional diterapkannya Metode Iqro’ pada pembelajaran membaca, menulis, berhitung (calistung), 2) penerapan Metode Iqro’ pada pembelajaran membaca, menulis, berhitung (calistung), 3) alasan warga belajar berminat dalam mengikuti pembelajaran membaca, menulis, berhitung (calistung) dengan penerapan Metode Iqro’. Untuk memahami dan mendiskripsikan Penerapan Metode Iqro’ pada pembelajaran membaca, menulis, berhitung (calistung) di Kelompok Belajar Merpati maka digunakan pendekatan kualitatif berupa studi kasus untuk mengungkap secara holistik fenomena yang terjadi secara menyeluruh dan mendalam pada Kelompok Belajar Merpati. Hal ini dilakukan untuk menemukan perspektif baru tentang fenomena tersebut yang sampai sekarang belum banyak diketahui dari segi program, peristiwa, proses (peristiwa). Sumber data dalam penelitian dikelompokkan menjadi 3 bagian, yaitu: person, place dan activity. Semua sumber data tersebut digali melalui tekhnik observasi partisipatif, wawancara mendalam dan dokumentasi. Berdasar analisis data, diperoleh temuan sebagai berikut: penerapan Metode Iqro’ diterapkan untuk warga belajar yang lebih bisa mengaji/ membaca huruf arab daripada membaca huruf latin; Metode Iqro’ hanya diterapkan pada tahap membaca permulaan sehingga digunakan sebagai pengantar belajar/ media pembelajaran, sebab Metode Iqro’ dalam penerapannya juga didukung oleh metode abjad; penerapan Metode Iqro’ didukung dengan teknik penyampaian yang menyenangkan, serta menjawab kebutuhan warga maka dapat menarik minat warga belajar untuk mau belajar. Hal ini terbukti bahwa minat dan antusias belajar warga sangat bagus ditinjau dari keseluruhan proses pembelajaran; Kelebihan Metode Iqro’ dapat memberikan kemudahan bagi tutor dalam menyampaikan materi dan bagi warga belajar mendapatkan kemudahan dalam menerima materi. Kekurangannya, semakin sering warga belajar tidak hadir maka akan semakin tertinggal, jika warga sama sekali tidak memahami huruf arab/ ataupun latin, maka akan berimbas pada lambatnya proses pembelajaran. Bertitik tolak dari hasil temuan penelitian tersebut, disarankan agar tutor hendaknya memahami kebutuhan belajar serta karakteristik warga belajar secara efektif dan efisien, sehingga dapat memilih dan menggunakan metode yang tepat dimana nantinya dapat merangsang minat dan motivasi belajar warga belajar dengan menjadikan Metode Iqro’ sebagai salah satu alternatif metode yang dapat diterapkan di Keaksaraan Fungsional; warga belajar hendaknya tetap semangat dalam belajar sekalipun Program Keaksaraan Fungsional telah usai dan mau mengaplikasikan ilmu yang diperoleh dalam kehidupan sehari- hari sehingga ilmu yang diperoleh tetap lestari; pengelola hendaknya melestarikan kegiatan belajar di masyarakat dengan program-program belajar yang inovatif dan sesuai dengan kebutuhan belajar. Hal ini digunakan supaya motivasi masyarakat tetap untuk terus belajar sepanjang hayat dimanapun berada; peneliti lain, apabila dalam penilitan ini masih terdapat kajian untuk melanjutkan upaya menumbuhkan minat warga dalam belajar dengan mengacu pada Metode Iqro’, peneliti siap untuk berbagi pengalamannya.

Identifikasi variasi genetik kerbau lokal Tana Toraja dan Lombok berbasis mikrosatelit sebagai bahan pengembangan materi ajar genetika populasi / Indah Rakhmawati Afrida

 

Kata kunci: variasi genetik, kerbau lokal Tana Toraja dan NTB, mikrosatelit, materi ajar. Perkembangan populasi, produksi dan produktivitas kerbau di Indonesia masih kurang baik, termasuk perbaikan mutu genetiknya masih tertinggal jauh dari ternak lainnya. Sebagai bagian dari keanekaragaman hayati asli Indonesia, kerbau belang merupakan hewan yang sangat penting dalam kehidupan sosial masyarakat Tana Toraja, Sulawesi Selatan, karena biasa digunakan dalam upacara adat, terutama pada acara pemakaman (rambu solo), sehingga mengakibatkan populasinya semakin berkurang. Fenomena ini memaksa masyarakat tersebut untuk mengambil pasokan kerbau dari propinsi di luar pulau Sulawesi, yaitu propinsi Nusa Tenggara Barat (NTB). Oleh karena itu, sebagai bentuk kepedulian terhadap kelestarian sumber daya hayati asli Indonesia, upaya penyelamatan kerbau belang dan kerbau Lombok dari kepunahan dirasa sangat perlu untuk segera dilakukan. Penelitian ini bertujuan untuk: 1) mengetahui perbedaan variasi fenotip kerbau lokal di Tana Toraja dan NTB, 2) mengetahui variasi genotip antara kerbau lokal Tana Toraja dan NTB dengan penanda mikrosatelit, dan 3) mengetahui implikasi hasil penelitian dapat digunakan sebagai bahan pengembangan materi kuliah Genetika Populasi di Perguruan Tinggi. Pengamatan pola variasi genetik dimulai dari tahapan isolasi DNA, dilanjutkan dengan elektroforesis gel agarose, tahapan PCR dengan 2 primer, yaitu INRA 032 (F = AAACTGTATTCTCTAATAGCTAC dan R = GCAAGACATATCTCCATTCCTTT) dan ETH 225 (F = GATCACCTTGCCACTATTTCCT dan R= ACATGACAGCCAGCTGCTTACT), dan dilanjutkan dengan elektroforesis gel poliakrilamid, sehingga didapatkan pita/band yang kemudian dianalisis dengan menggunakan GENEPOP ver.3.1d. Hasil analisis menunjukkan bahwa variasi genetik populasi kerbau Tana Toraja lebih tinggi dibandingkan dengan kerbau Lombok. Hal ini dapat dilihat dari nilai rata-rata heterozigositas dan rata-rata nilai informasi polimorfik alel. Nilai rata-rata heterozigositas pada populasi kerbau Tana Toraja dari kedua lokus mikrosatelit sebesar 39,29% lebih tinggi daripada populasi kerbau Lombok sebesar 36,61%. Rata-rata nilai informasi polimorfik alel pada populasi kerbau Tana Toraja adalah 36,24% lebih tinggi daripada populasi kerbau Lombok adalah 34,94%. Populasi kerbau secara umum berada dalam keseimbangan Hardy-Weinberg dan telah terjadi migrasi alel di antara kedua populasi tersebut yaitu sebesar 13,39% yang diduga telah terjadi breeding pada kedua populasi kerbau tersebut. Hasil penelitian ini dapat diaplikasikan dalam pembelajaran terutama untuk pengembangan materi ajar matakuliah Genetika Populasi beserta petunjuk praktikumnya. Berdasarkan hasil validasi dari ahli isi matakuliah, bahan ajar (87,69%) dan petunjuk praktikum (92,50%) yang telah disusun sudah sangat baik dan dapat digunakan oleh dosen dan mahasiswa Program Studi Pendidikan Biologi untuk lebih memahami prinsip-prinsip dasar Genetika khususnya Genetika Populasi.

Penerapan grup investigasi untuk memahamkan operasi pecahan pada siswa kelas VII-A di SMP Negeri 4 Kepanjen dengan menggunakan pita pecahan / Ulfiah Falufi

 

Kata Kunci : Pemahaman, Operasi pecahan, Grup Investigasi, Pita pecahan Pecahan merupakan materi matematika di SMP yang masih perlu untuk dikaji, meskipun materi ini telah diajarkan di SD. Walle (2008; 286) mengemukakan pecahan selalu menjadi tantangan yang berat untuk siswa bahkan di tingkat pertengahan (midlle grades/SMP). Hal serupa juga terjadi di SMP Negeri 4 Kepanjen, skor rata-rata ulangan harian materi pecahan kelas VII- D tahun pelajaran 2009/2010 hanya mencapai 56 dan hanya 4 siswa (dari 24 siswa) yang memenuhi Kriteria Ketuntasan Minimal (KKM) matematika yaitu 75. Salah satu alternatif metode mengajar yang melibatkan siswa secara aktif dalam mengorganisasikan dan menemukan hubungan-hubungan dari informasi yang diperoleh adalah Grup Insvestigasi (GI). Mengingat siswa SMP kemampuan berfikir masih terkait dengan benda-benda konkret/semikonkret dan belum mampu berfikir deduktif secara sempurna, maka untuk mempermudah dalam menginvestigasi peneliti menggunakan model yaitu pita pecahan. Penelitian ini bertujuan untuk memperoleh paparan yang jelas tentang pembelajaran operasi pecahan yang menerapkan Grup Investigasi dengan menggunakan pita pecahan yang dapat memahamkan siswa. Jenis penelitian ini adalah Penelitian Tindakan Kelas (PTK). Penelitian ini terdiri dari dua siklus, pada siklus pertama terdiri dari dua pertemuan dan pada siklus kedua terdiri satu pertemuan. Sumber data yang digunakan dalam penelitian ini adalah seluruh siswa kelas VII-A SMPN 4 Kepanjen yang terdiri dari 29 siswa. Dari hasil penelitian, langkah-langkah pembelajaran yang dapat memahamkan siswa terdiri dari enam tahap, yaitu (1) mengidentifikasi topik dan mengatur siswa dalam kelompok, (2) merencanakan tugas yang akan dipelajari (3) melaksanakan investigasi, (4) menyiapkan laporan akhir, (5) mempresentasikan laporan akhir dan (6) evaluasi. Bagi guru yang ingin menerapkan Grup Investigasi dalam pembelajaran matematika disarankan untuk memberikan latihan soal yang bervariasi, yang bertujuan untuk lebih memantapkan pemahaman yang diperoleh.

Analisis faktor-faktor yang mempengaruhi minat siswa kelas X SMA Negeri pada pemilihan jurusan (studi kasus pada siswa SMA Negeri 3 Malang) / Elza Septiana

 

Kata kunci: faktor internal, faktor eksternal, dan minat. Penjurusan merupakan proses yang harus dilalui oleh siswa kelas X SMA yang hendak naik ke kelas XI. Minat merupakan suatu kesukaan atau ketertarikan terhadap sesuatu. Minat seorang siswa dipengaruhi oleh beberapa faktor, baik itu faktor dari dalam diri sendiri (faktor internal) ataupun dari pihak luar (faktor eksternal). Faktor internal tersebut ialah bakat dan cita-cita, sedangkan faktor eksternal meliputi lingkungan keluarga, teman sebaya, dan masyarakat. Sehingga, secara langsung atau tidak minat siswa pada salah satu jurusan dipengaruhi oleh faktor-faktor tersebut. Tujuan penelitian tersebut ialah untuk mengetahui pengaruh dari faktor internal dan eksternal terhadap minat siswa kelas X reguler SMA Negeri 3 Malang pada pemilihan jurusan, baik secara parsial ataupun simultan. Populasi penelitian tersebut ialah siswa kelas X reguler SMA Negeri 3 Malang yang berjumlah 260 siswa dengan sampel sebesar 149 siswa. Pengambilan sampel penelitian tersebut menggunakan teknik probability sampling. Sedangkan metode analisis yang digunakan ialah analisis deskriptif dan regresi linear berganda. Berdasarkan hasil penelitian, diketahui bahwa variabel faktor internal (X1) dan faktor eksternal (X2) memiliki tingkat signifikansi kurang dari alpha (0,005) pada uji t, yaitu masing-masing dengan nilai 0,000. Sedangkan nilai signifikansi pada uji F ialah sebesar 0,000, kurang dari nilai alpha (0,005). Sehingga, dapat disimpulkan bahwa Faktor Internal (X1) dan Faktor Eksternal (X2) berpengaruh positif dan signifikan secara parsial maupun simultan terhadap minat siswa kelas X reguler SMA Negeri 3 Malang pada pemilihan jurusan. Saran yang dapat direkomendasikan ialah bagi guru dan sekolah untuk memperhatikan faktor yang mempengaruhi minat siswa dalam memilih jurusan, sehingga siswa dapat diarahkan pada pilihan jurusan yang tepat. Sedangkan bagi siswa, supaya menyelaraskan antara faktor internal dan eksternal supaya memperoleh keputusan jurusan yang tepat sehingga dapat membantu dalam pembelajaran selanjutnya dan cita-cita siswa.

Developing English instructional materials for the first-year students of agronomy at SMK Negeri 1 Sukorambi Jember / Rina Sofia

 

Key words: instructional materials, materials development, Agronomy department. This study aims at developing English instructional materials for the first- year students of Agronomy. The developed materials were made because of the lack of English materials especially for agriculture schools. The available materials were usually for vocational schools majoring in engineering and economics. The study employed Research and Development (R and D) design. To obtain the information needed as a base for developing materials, an informal observation was done. In addition, needs analysis was carried out by having a checklist of a book used by the teacher. Besides, the teacher was interviewed and 68 students of two classes from Agronomy department were asked to answer the questionnaires. The procedures employed in this study were doing needs analysis, developing the materials, conducting validation including expert validation and trying-out the materials. In doing needs analysis, interview was given to the teacher and questionnaires were distributed to the students, while expert judgment was done by giving questionnaire to the experts. Questionnaires were also given to the students after the materials were tried out. The result of needs analysis showed that the students needed English instructional materials that had colourful pictures and photos to make them easier to understand the materials and the materials should be relevant to their major content subject, Agronomy. Besides, the data gathered from expert judgment indicated that some revision should be done for the developed materials. In trying-out of the developed materials, the data were taken by doing observation and giving questionnaires to students. The observation showed that students were actively involved in the learning and teaching process. They were interested in the topics because they related to the students major content subject. In addition, the result of questionnaires showed that most of the students stated that the developed materials were very useful to improve their English and to support’ the productive subjects.’ Based on the result of the try-out, some revisions were made to improve the quality the materials to match the needs of the students. The success in using the developed materials as shown in the try-out should be continued by other English teachers, the school/institution, material developers, and other researchers. The English teachers can make use the developed materials as an alternative source of materials. They can also use it as a model to develop materials for other departments or other skill programs. Besides, for the school principal, it is hoped that he can facilitate the teacher to publish the developed materials for the internal use. For materials developers, the result of this study can be used as a model to develop the other materials by considering the students’ context. For other researchers, this developed materials can be used as a model to conduct the same research for different levels or other departments.

Analisis pengaruh nilai tukar rupiah/US$ dan tingkat suku bunga SBI terhadap indeks harga saham gabungan di Bursa Efek Indonesia tahun 2007-2008 / Eprisiya Wuri Dian Trinisa

 

Kata kunci: nilai tukar rupiah/US$, tingkat suku bunga SBI, indeks harga saham gabungan IHSG merupakan cerminan dari kegiatan pasar modal secara umum. Peningkatan IHSG menunjukkan kondisi pasar modal sedang bullish, sebaliknya jika menurun menunjukkan kondisi pasar modal sedang bearish. Kejadian tersebut dipengaruhi oleh beberapa faktor baik mikro maupun makroekonomi. Diantara faktor makroekonomi yang mempunyai peranan penting dalam pergerakan IHSG adalah nilai tukar rupiah/US$ dan tingkat suku bunga SBI. Penelitian ini bertujuan untuk mengetahui pengaruh nilai tukar rupiah/US$ dan tingkat suku bunga SBI terhadap IHSG. Populasi penelitian ini adalah indeks harga seluruh saham yang ada di BEI yang terdaftar dari 1 Januari 2007 sampai 31 Desember 2008. Penentuan sampel dalam penelitian ini yaitu menggunakan sampling jenuh atau sampling sensus, yaitu teknik penentuan sampel dimana semua anggota populasi digunakan sebagai sampel, sehingga diperoleh 24 sampel. Data dalam penelitian ini merupakan data kuantitatif yang dikumpulkan secara times series yang diambil berdasarkan studi pustaka atau dokumentasi. Data yang dikumpulkan dianalisis dengan teknik regresi linier berganda (multiple regression analysis model). Hasil penelitian menunjukkan bahwa (1) Secara parsial terdapat pengaruh negatif signifikan Nilai Tukar Rupiah/US$ terhadap IHSG (2) Secara parsial terdapat pengaruh positif signifikan Tingkat Suku Bunga SBI terhadap IHSG (3) Secara simultan terdapat pengaruh yang sangat signifikan antara Nilai Tukar Rupiah/US$ dan Tingkat Suku Bunga SBI terhadap IHSG. Hasil penelitian ini diharapkan dapat bermanfaat bagi investor, perusahaan, pemerintah dan peneliti selanjutnya. Bagi peneliti selanjutnya disarankan menambah variabel lain yang berpotensi mempengaruhi IHSG yang ada di BEI seperti pertumbuhan ekonomi, inflasi, PDB, faktor mikro ekonomi dan faktor fundamental. Periode pengamatan dan sampel bisa ditambah atau bahkan meneliti indeks-indeks lain yang ada di BEI.

Pengaruh soft competency karyawan terhadap kinerja karyawan (studi pada karyawan PT. Taspen Cabang Malang) / Devi Maya Rosa

 

Kata kunci: Soft Competency Karyawan, Kinerja Karyawan Menciptakan keunggulan bersaing menjadi prioritas utama bagi para pemimpin perusahaan dalam mengelola perusahaan mereka agar dapat memenangi persaingan usaha yang sangat ketat. Hal yang dapat dilakukan adalah dengan mencari keunggulan pada sumber daya manusia yang dimiliki, melalui kreativitas yang mereka hasilkan dan keunikan yang mereka miliki melalui kompetensi. Penerapan kompetensi di perusahaan tidak dapat dipisahkan dari soft competency dan hard competency karyawan. Kompetensi mempengaruhi cara pandang, tindakan dan karakter seseorang. Karyawan yang memiliki soft competency yang seimbang dengan hard competency yang dimiliki, akan dapat menggunakan pemikiran intelektual dan emosinya sesuai dengan yang dibutuhkan pekerjaan, sehingga karyawan tersebut dapat berprestasi unggul dalam bekerja. Tujuan penelitian ini adalah ingin mengetahui soft competency (kompetensi inti dan kompetensi pendukung) karyawan, kinerja karyawan di PT. TASPEN (Persero) Cabang Malang, mengetahui variabel-variabel soft competency (kompetensi inti dan kompetensi pendukung) yang berpengaruh secara parsial maupun simultan terhadap kinerja karyawan, serta untuk mengetahui sub variabel soft competency (kompetensi inti dan kompetensi pendukung) mana yang berpengaruh dominan terhadap kinerja karyawan. Penelitian ini merupakan penelitian descriptive research dan explanatory research, yaitu penelitian yang menjelaskan keadaan di lapangan dari objek yang diteliti serta menjelaskan hubungan kausal antara variabel-variabel melalui pengujian hipotesis pada data yang sama. Penelitian ini mempunyai dua variabel, yaitu variabel bebas (X) dan variabel terikat (Y). Variabel bebas (X) terdiri dari sub variabel: kompetensi inti (X1) dan kompetensi pendukung (X2), sedangkan variabel terikat (Y) adalah kinerja karyawan. Sampel yang digunakan dalam penelitian ini dengan menggunakan sampling jenuh yaitu seluruh karyawan pelaksana PT. TASPEN (Persero) Cabang Malang yang berjumlah 31 orang. Dianalisis dengan analisis regresi linier berganda dengan uji hipotesis menggunakan uji t dan uji F. Berdasarkan hasil penelitian ini diketahui bahwa kompetensi inti (X1) dan kompetensi pendukung (X2) mempunyai thitung masing-masing (3,684; 2,573) sedangkan nilai Fhitung Sebesar 19,800 dengan tingkat signifakansi sebesar 0,000 lebih kecil dari nilai α = 0,05. Berdasarkan hasil tersebut dapat disimpulkan soft competency karyawan yang terdiri dari kompetensi inti (X1) dan kompetensi pendukung (X2) berpengaruh positif dan signifikan terhadap kinerja karyawan (Y) baik secara parsial maupun simultan. Sedangkan variabel yang paling dominan mempengaruhi kinerja karyawan adalah kompetensi inti karena memiliki nilai standart koefisien (Beta) 0,518 lebih tinggi dibandingkan dengan variabel yang lain. Saran yang dapat direkomendasikan terkait dengan hasil penelitian yang didapatkan adalah: (1) bagi pimpinan PT. TASPEN (Persero) Cabang Malang, sebaiknya dilakukan pelatihan dan seminar mengenai soft competency yang lebih bervariasi secara kontinyu, (2) bagi karyawan PT. TASPEN (Persero) Cabang Malang, alangkah baiknya jika karyawan bersedia meluangkan waktu di luar jam kerja untuk membaca buku-buku tentang kepribadian, motivasi dalam bekerja, mengikuti program seminar dan pelatihan mengenai hard competency dan soft competency yang dilakukan di dalam perusahaan maupun di luar perusahaan, (3) bagi peneliti selanjutnya, penelitian lanjutan perlu dilakukan dengan memperluas variabel yang diteliti maupun pengembangan indikator serta item lain yang diduga juga saling mempengaruhi antara soft competency dengan variabel yang lain, misalnya dengan mencoba melakukan penelitian di perusahaan lain, atau menambah jumlah wilayah penelitian sehingga hasil kesimpulan dari penelitian dapat lebih mewakili (representative) secara umum (general).

Pengaruh penerapan model problem based learning (PBL) terhadap prestasi belajar fisika ditinjau dari motivasi pada siswa kelas X SMK Negeri 3 Boyolangu Tulungagung / Sumarni

 

Kata kunci: problem based learning, prestasi, belajar Pengaruh penerapan model problem based learning (PBL) pada pembelajaran fisika memiliki dampak yang sangat baik terhadap motivasi dan prestasi siswa. Model PBL dilakukan dengan memberikan orientasi permasalahan secara langsung terhadap siswa sesuai materi yang diajarkan dan siswa dapat mengamati sesuai dengan pengalaman sehari-hari dan sekaligus memecahkan masalah sendiri. Gejala yang ada banyak siswa memiliki pengetahuan faktual yang cukup tetapi gagal menggunakan pengetahuannya saat memecahkan masalah. Salah satu faktor penyebab gagalnya pembelajaran di kelas adalah proses pembelajaran yang didominasi guru, model pembelajaran yang tidak mendukung aktifitas siswa maka perlu adanya perubahan model pembelajaran yang digunakan. Tujuan penelitian ini adalah: 1) Menguji ada perbedaan prestasi belajar fisika antara siswa yang belajar dengan model PBL dan konvensional. 2) Menguji perbedaan prestasi belajar fisika antara siswa yang belajar dengan model PBL dan model konvensional di kelompok siswa bermotivasi tinggi dan rendah.3) Menguji interaksi antara model pembelajaran dengan motivasi. Metode penelitian yang digunakan adalah kuasi eksperimen,dengan variabel bebas mode Pembelajaran dan model Konvesional, variabel terikatnya prestasi belajar siswa dan sebagai variabel moderat adalah motivasi belajar. Penelitian ini dilakukan di SMK Negeri 3 Boyoalngu Tulungagung Tahun Pelajaran 2009/2010. Data dianalisis dengan statistik ANAVA Dua Jalur dan uji Tukey. Pengujian hipoteis nol dilakukan pada taraf signifikan 5%. Hasil penelitian menunjukkan temuan-temuan sebagai berikut.1) Terdapat perbedaan prestasi belajar fisika antara siswa yang belajar dengan model PBL dan konvensional. 2) Terdapat perbedaan prestasi belajar fisika antara siswa yang belajar dengan model PBL dan model konvensional di kelompok siswa bermotivasi tinggi 3) Terdapat interaksi antara model dengan motivasi belajar yang berpengaruh terhadap prestasi belajar siswa.

Pengaruh bauran promosi terhadap keputusan konsumen dalam menggunakan internet Speedy (studi pada pengguna jasa di warnet Starnet Malang) / Listy Putriyatni

 

Kata Kunci : Bauran promosi, keputusan menggunakan internet Speedy. Internet merupakan kebutuhan bagi banyak orang karena dengan internet kita dapat mengakses berbagai hal yang ingin kita ketahui sebagai bahan perkembangan yang lebih maju dan bermanfaat bagi kita. Adapun penyelenggara jasa internet (PJI) atau yang biasa disebut dengan Internet Service Provider (ISP) yakni perusahaan atau badan yang menyelenggarakan jasa sambungan internet dimana ISP ini memiliki jaringan lingkup domestik maupun internasional sehingga pengguna jasa ini dapat terhubung ke jaringan internet global dengan menggunakan jaringan yang telah disediakan oleh ISP. Dengan banyaknya minat masyarakat terhadap internet maka muncullah berbagai produk layanan internet di Indonesia, salah satunya adalah Speedy yakni produk layanan internet accses end-to-end dari Telkom dengan basis teknologi Asymetric Digital Subscriber Line (ADSL), yang dapat menyalurkan data dan suara secara simultan melalui satu saluran telepon biasa dengan kecepatan yang dijamin hingga 384 Kbps, Speedy diposisikan sebagai produk akses internet cepat. Penelitian ini memiliki empat tujuan, yaitu (1) untuk mengetahui gambaran bauran promosi, (2) untuk mengetahui gambaran keputusan konsumen, (3) untuk mengetahui pengaruh bauran promosi secara parsial terhadap keputusan konsumen, (4) untuk mengetahui pengaruh bauran promosi secara simultan terhadap keputusan konsumen. Penelitian ini menggunakan dua buah variabel yaitu variabel bebas (X) bauran promosi yang terdiri dari sub variabel periklanan (X1), personal selling (X2), promosi penjualan (X3), dan publisitas (X4). Sedangkan variabel terikat (Y) yaitu keputusan kosumen. Populasi dari penelitian ini adalah para pengguna jasa di Warnet Starnet Malang dengan menggunakan rumus infinite. Sedangkan sampel dalam penelitian ini berjumlah 140 responden. Sampel diambil dengan menggunakan teknik Accidental Sampling. Instrumen penelitian yang digunakan adalah kuesioner. Dalam penelitian ini jawaban responden diukur dengan skala Likert, adapun bentuk alternatif jawaban dalam pemberian skor penilaian adalah sangat setuju skor 5, setuju skor 4, kurang setuju skor 3, tidak setuju skor 2, dan sangat tidak setuju skor 1. Hasil analisis deskriptif penelitian ini menunjukkan bahwa: (1) pada variabel periklanan lebih dari 60% responden menjawab setuju, (2) pada variabel penjualan pribadi 45% responden menjawab setuju, (3) pada variabel promosi penjualan 65% responden menjawab sangat setuju, (4) pada variabel publisitas 60% responden menjawab setuju, dan (5) pada variabel keputusan konsumen 70% responden menjawab setuju. Sedangkan hasil analisis inferensial penelitian ini adalah: (1) variabel periklanan (X1) memiliki nilai thitung = 3,224 dengan nilai B = 0,255. Nilai ini selanjutnya dikonsultasikan dengan nilai ttabel 1,9771 sehingga thitung > ttabel atau signifikansi t 0,002 ≤ 0,005. Dengan demikian variabel periklanan berpengaruh positif yang signifika terhadap keputusan konsumen, (2) variabel personal selling memiliki nilai thitung = 0,321 dengan nilai B = 0,024. Nilai ini selanjutnya dikonsultasikan dengan nilai ttabel 1,9771 sehingga thitung ≤ ttabel atau signifikansi t 0,749 > 0,05. Dengan demikian variabel personal selling tidak berpengaruh positif yang signifikan terhadap keputusan konsumen, (3) variabel promosi penjualan memiliki nilai thitung = 1,753 dengan nilai B = 0,344. Nilai ini selanjutnya dikonsultasikan dengan nilai ttabel 1,9771 sehingga thitung ≤ ttabel atau signifikansi t 0,082 > 0,05. Dengan demikian variabel promosi penjualan tidak berpengaruh positif yang signifikan terhadap keputusan konsumen, (4) variabel publisitas memiliki nilai thitung = 1,766 dengan nilai B = 0,311. Nilai ini selanjutnya dikonsultasikan dengan nilai ttabel 1,9771 sehingga thitung ≤ ttabel atau signifikansi t 0,080 > 0,05. Dengan demikian variabel publisitas tidak berpengaruh positif yang signifikan terhadap keputusan konsumen. Selain itu, didapatkan juga nilai Fhitung 5,502 > Ftabel 2,28 atau signifikansi F 0,000 ≤ 0,05, yang berarti terdapat pengaruh positif yang signifikan faktor bauran promosi yang terdiri dari periklanan, personal selling, promosi penjualan, dan publisitas terhadap keputusan konsumen dalam menggunakan internet Speedy sebesar 11,5%, sedangkan sisanya 88,5% dipengaruhi oleh faktor-faktor lain diluar penelitian. Kecilnya nilai bauran promosi terhadap keputusan konsumen dalam menggunakan internet Speedy pada Warnet Starnet Malang ini karena dipengaruhi beberapa faktor, antara lain produk yang ditawarkan, harga, lokasi, brand name, faktor-faktor yang mempengaruhi keputusan konsumen dalam melakukan pembelian dan sebagainya. Kesimpulan yang berkaitan dengan temuan yang diperoleh selama pelaksanaan penelitian ini adalah (1) gambaran umum bauran promosi produk Speedy oleh PT. Telkom yaitu periklanan, personal selling, promosi penjualan, dan publisitas pada internet Speedy berdasarkan jawaban dari responden yaitu responden merasa lebih puas menggunakan produk internet Speedy di bandingkan dengan produk yang lain, (2) gambaran umum keputusan konsumen dalam menggunakan internet Speedy yaitu di latarbelakangi oleh berbagai macam tahap dalam mengambil tindakan keputusan untuk menggunakan produk Speedy, (3) periklanan berpengaruh secara positif signifikan terhadap keputusan konsumen dalam menggunakan internet Speedy, sedangkan personal selling, promosi penjualan, dan publisitas tidak berpengaruh secara positif signifikan terhadap keputusan konsumen dalam menggunakan internet Speedy, dan (4) bauran promosi yang terdiri dari periklanan, personal selling, promosi penjualan, dan publisitas secara simultan berpengaruh positif yang signifikan terhadap keputusan konsumen dalam mengggunakan internet Speedy. Saran yang dapat diberikan oleh peneliti adalah (1) Saran ditujukan kepada PT. Telkom selaku penyedia produk Speedy, terkait dengan kecepatan akses internet ditambahkan karena kadang-kadang sangat lambat ketika jam kerja dimulai. Walaupun paket Speedy yang digunakan sudah termasuk paket unlimited atau paket di atas rata-rata, (2) PT. Telkom Speedy sebaiknya lebih memperdalam pengetahuan tentang apa yang menjadi kebutuhan konsumen, memperbaiki persepsi konsumen yang memiliki persepsi negatif terhadap produk Speedy, menambah pengetahuan konsumen mengenai produk Speedy melalui iklan maupun pameran sehingga akan mampu mempengaruhi konsumen sehingga terdorong untuk membeli dan menggunakan produk Speedy, dan (3) Bagi peneliti selanjutnya disarankan untuk menambah jumlah variabel penelitian yang dapat mempengaruhi keputusan konsumen selain variabel yang diteliti pada penelitian ini. Selain itu menyempurnakan kekurangan-kekurangan dalam penelitian ini dan dapat dijadikan dasar pertimbangan ilmiah bagi kesempurnaan yang ada.

Hubungan antara pola asuh dan status sosial ekonomi orang tua dengan hasil belajar ekonomi siswa (Studi kasus pada siswa kelas XI IPS SMAN 5 Malang) / Dwi Indri Astuti

 

Kata kunci: Pola Asuh Orang tua , Status Sosial Ekonomi Orang Tua, Hasil Belajar Ekonomi. Pola asuh tua adalah merupakan cara, bentuk atau strategi yang digunakan dalam lingkungan keluarga yang dilakukan oleh orang tua kepada anaknya sebagai upaya untuk mendidik anak-anak tersebut. Ekonomi orang tua merupakan penentu perkembangan dan pendidikan anak-anak, Masalah dalam penelitian ini yaitu (1) Bagaimana pola asuh orang tua siswa di SMA N 5 Malang tahun ajaran 2010/2011 ? (2) Bagaimana status sosial ekonomi siswa SMA N 5 Malang tahun ajaran 2010/2011 ? (3) Bagaimana keberhasilan belajar siswa SMA N 5 Malang tahun ajaran 2010/2011? (4) Apakah terdapat hubungan pola asuh orang tua terhadap keberhasilan belajar siswa di SMA N 5 Malang tahun ajaran 2010/2011 ? (5) Apakah terdapat hubungan status sosial ekonomi siswa terhadap keberhasilan belajar siswa di SMA N 5 Malang tahun ajaran 2010/2011 ?. Tujuan penelitian ini adalah (1) Untuk mengetahui pola asuh orang tua siswa di SMA N 5 Malang tahun ajaran 2010/2011, (2) Untuk mengetahui status social ekonomi siswa SMA N 5 Malang tahun ajaran 2010/2011, (3) Untuk mengetahui keberhasilan belajar siswa SMA N 5 Malang tahun ajaran 2010/2011, (4) Untuk menganalisis hubungan pola asuh orang tua terhadap keberhasilan belajar siswa di SMA N 5 Malang tahun ajaran 2010/2011, (5)Untuk menganalisis hubungan status sosial ekonomi siswa terhadap keberhasilan belajar siswa SMA N 5 Malang tahun ajaran 2010/2011. Rancangan penelitian yang digunakan adalah Rancangan deskriptif korelasional. Populasi pada penelitian ini adalah seluruh siswa kelas XI IPS SMA N 5 Malang. Penelitian ini merupakan penelitian populasi. Instrumen yang digunakan adalah angket dan dokumentasi. Analisis deskriptif korelasional dengan menggunakan uji Chi Square digunakan menentukan ada tidaknya hubungan antara variabel pola asuh orang tua (X1) dan status sosial ekonomi orang tua (X2) dengan variabel keberhasilan belajar ekonomi siswa (Y). Sedangkan hasil dari uji Chi Square diketahui bahwa ada hubungan antara pola asuh dan status social ekonomi orang tua dengan hasil belajar ekonomi siswa kelas XI IPS SMA N 5 Malang. Dilihat dari nila pearson Chi Square dan Asymp sig dari pengujian hipotesis. Bertitik tolak dari hasil penelitian ini, diajukan saran (1) Bagi siswa sebagai motivasi untuk meningkatkan komunikasi yang baik antara siswa dengan orang tua, (2) Bagi orang tuadapat mengetahui pentingnya peran orang tua terhadap keberhasilan belajar siswa, (3) Bagi sekolah dapat dijadikan sebagai bahan pertimbangan dalam merencanakan program sekolah, (4) Bagi peneliti lain dapat digunakan sebagai bahan masukan untuk menambah pengetahuanan tentang pola asuh orang tua dan status social ekonomi terhadap keberhasilan belajar siswa.

Pengaruh jenis dan konsentrasi rumput laut dalam cookies sagu terhadap kadar iodium tikus (Rattus novergicus) serta implementasinya untuk pendidikan masyarakat di Kabupaten Maluku Tengah / Zasendy Rehena

 

Kata Kunci: rumput laut, cookies sagu, kadar iodium, pendidikan masyarakat. Gangguan akibat kekurangan iodium (GAKI) merupakan masalah gizi yang sangat serius, karena berpengaruh terhadap kelangsungan hidup dan kualitas sumber daya manusia. Efek yang sangat dikenal orang akibat kekurangan iodium adalah gondok (goiter), yakni pembesaran kelenjar tiroid di daerah leher dan menderita kecacatan mental, yakni cebol, bisu, tuli, dan kelainan mental. Hasil survei pada tahun 1998 didapatkan gondok untuk tingkat nasional adalah 9,8% dan pada tahun 2003 naik menjadi 11,1%. Propinsi dengan Total Goiter Rate (TGR) tertinggi tahun 2003 adalah Nusa Tenggara Timur, yaitu 33.39% diikuti oleh Propinsi Maluku dan Jawa Tengah yakni 31,6% dan 22,4%. Kabupaten Maluku Tengah memiliki angka prevalensi GAKI sangat tinggi, yaitu 33,39%. Strategi yang telah dilakukan pemerintah untuk menurunkan jumlah penderita GAKI adalah memberikan suplemen kapsul minyak beriodium di daerah endemik, program iodisasi garam, dan diversifikasi konsumsi pangan sumber iodium, yakni mulai dicarinya alternatif bahan pangan lokal seperti rumput laut. Rumput laut mengandung iodium yang tinggi dan dapat dikonsumsi untuk mencegah kekurangan iodium. Kabupaten Maluku Tengah memiliki potensi rumput laut yang melimpah dan berkualitas, akan tetapi tingkat konsumsi secara langsung oleh masyarakat sebagai bahan pangan masih rendah, dengan demikian perlu pengembangan teknologi pangan yang memanfaatkan rumput laut untuk menghasilkan produk makanan selingan/jajanan yang sering dikonsumsi oleh masyarakat luas dan lebih disukai oleh anak-anak yaitu cookies. Cookies umumnya terbuat dari bahan baku tepung terigu namun dapat digantikan dengan memanfaatkan tepung sagu yang kaya akan karbohidrat (pati). Dengan adanya potensi pangan lokal maka penting diciptakan suatu produk pangan yang dapat memenuhi kriteria sebagai pangan alternatif, yaitu cookies dari tepung sagu dengan penambahan rumput laut sebagai sumber iodium dan zat gizi lain yang diperlukan tubuh. Tujuan penelitian ini adalah untuk mengetahui: 1) Pengaruh jenis dan konsentrasi rumput laut terhadap kandungan karbohidrat, protein, serat, vitamin A, dan iodium cookies sagu, 2) pengaruh jenis dan konsentrasi rumput laut dalam cookies sagu terhadap kadar iodium tikus (Rattus norvegicus), 3) penerimaan masyarakat terhadap produk cookies yang dihasilkan dalam penelitian ini, dan 4) pengetahuan masyarakat mengenai GAKI dan pemanfaataan rumput laut untuk mencegah kekurangan iodium. Kegiatan penelitian ini terdiri dari 4 tahapan, yakni: 1) Penelitian eksperimen I untuk menguji pengaruh jenis dan konsentrasi rumput laut terhadap kandungan karbohidrat, protein, serat, vitamin A, dan iodium cookies sagu, 2) penelitian eksperimen II untuk mengetahui pengaruh jenis dan konsentrasi rumput laut dalam ransum cookies sagu terhadap kadar iodium tikus, 3) uji organoleptik, 4) kegiatan penyuluhan bagi masyarakat di Kabupaten Maluku Tengah. Hasil penelitian ekperimen I menunjukkan bahwa penambahan rumput laut dapat meningkatkan kandungan serat, vitamin A, dan iodium pada cookies sagu, sedangkan kandungan karbohidrat dan protein menjadi menurun seiring dengan penambahan rumput laut. Hasil uji hipotesisnya menunjukkan ada pengaruh yang nyata dari jenis dan konsentrasi rumput laut terhadap kandungan karbohidrat, protein, serat, vitamin A dan iodium. Interaksi jenis dan konsentrasi rumput laut berpengaruh nyata terhadap kandungan protein, vitamin A, serta iodium dan tidak berpengaruh nyata terhadap kandungan karbohidrat dan serat cookies. Uji lanjut LSD memperlihatkan bahwa ada pengaruh perlakuan interaksi jenis dan konsentrasi rumput laut terhadap kandungan protein, vitamin A, dan iodium. Hasil uji pendahuluan pada tahap eksperimen II menunjukkan bahwa tikus yang diberikan ransum standar kurang iodium memiliki kadar iodium berkategori defisiensi sedang, dan tikus yang diberi ransum cukup iodium memiliki kadar iodium normal. Hasil Penelitian utama menunjukkan bahwa pemberian ransum cookies yang mengandung Sargassum crassifolium 20%, 30%, dan 40%, juga Eucheuma cottonii 30% dan 40% dapat meningkatkan kadar iodium tikus menjadi optimal. Hasil uji hipotesis menunjukkan bahwa perlakuan jenis dan konsentrasi rumput laut dalam ransum cookies serta interaksinya berpengaruh nyata terhadap kadar iodium tikus. Interaksi jenis Sargassum crassifolium 40% lebih berpengaruh dalam meningkatkan kadar iodium tikus. Hasil uji organoleptik menunjukkan penerimaan masyarakat pada aspek warna, rasa dan kerenyahan yang tertinggi pada cookies dengan perlakuan jenis Eucheuma cottonii 30%, sedangkan dari aspek aroma hasil respons masyarakat yang tertinggi pada perlakuan jenis Eucheuma cottonii 20%, akan tetapi pada perlakuan Eucheuma cottonii 30% juga mendapat respon yang baik dari masyarakat, dengan frekuensi yang tidak jauh berbeda dengan Eucheuma cottonii 20%, sehingga kecenderungan penerimaan masyarakat adalah cookies dengan perlakuan jenis Eucheuma cottonii 30%. Hasil penelitian pendidikan masyarakat menunjukkan bahwa tidak ada perbedaan pengetahuan masyarakat berdasarkan tingkat pendidikan. Setelah kegiatan penyuluhan dilakukan terjadi peningkatan pengetahuan masyarakat dan peningkatan yang tertinggi pada masyarakat yang berpendidikan rendah. Berdasarkan hasil penelitian ini disarankan beberapa penelitian lanjutan antara lain: 1) Jenis Sargassum crassifolium lebih berpotensi dalam meningkatkan kadar iodium dalam tubuh hewan coba, namun secara organoleptik kurang mendapat respons yang baik dari masyarakat, sehingga perlu dikembangkan dalam produk makanan lain yang secara organoleptik dapat diterima oleh masyarakat, 2) perlu diketahui apakah ada interaksi antara iodium dengan zat gizi lainnya yang terkandung dalam ransum cookies terhadap penyerapan iodium dalam tubuh, 3) rumput laut telah diketahui sebagai pangan sumber iodium, perlu dikembangkan pembudidayaannya terutama pada jenis Eucheuma cottonii dan Sargassum crassifolium di Kabupaten Maluku tengah, 4) perlu dipertimbangkan oleh pengelola program pemberian makanan tambahan anak sekolah (PMT-AS) di Kabupaten Maluku Tengah .

Pengembangan media hybrid learning pada mata pelajran kimia SMA kelas X dalam materi hidrokarbon / Ivatul Laily Kurniawati

 

Program Studi Setingkat Jurusan Kimia. PPS. Universitas Negeri Malang. Pembimbing: (I) Drs. I Wayan Dasna, M.Si., M.Ed., Ph.D (II) Surjani Wonorahardjo, Ph.D Kata kunci: media Hybrid Learning, hybrid learning, hidrokarbon Salah satu materi yang dibelajarkan di SMA adalah hidrokarbon. Materi ini cukup padat, sehingga membutuhkan waktu yang panjang dalam penyampaiannya di kelas. Penggunaan waktu yang panjang tersebut, menyebabkan pembelajaran kimia organik tidak hanya dibutuhkan pendekatan pembelajaran yang lebih inovatif dan menarik, tetapi juga diperlukan media pembelajaran. Oleh karena itu perlu dikembangkan suatu media yang dapat mengintegrasikan antara pendekatan pembelajaran dengan media pembelajaran berbasis ICT yang dapat digunakan sebagai alternatif untuk memperbaiki hasil belajar kimia, khususnya pada materi senyawa hidrokarbon. Pengembangan media ini bertujuan untuk (1) mengembangkan media Hybrid Learning pada materi hidrokarbon, (2) mengetahui kelayakan media pembelajaran Hybrid Learning hasil pengembangan dalam materi pokok senyawa hidrokarbon, dan (3) mengetahui efektivitas penggunaan media hasil pengembangan dibandingkan dengan pembelajaran tanpa menggunakan media pembelajaran Hybrid Learning. Pengembangan dilakukan dengan menggunakan model pengembangan 4D yang mencakup tahap-tahap: define, design, develop, dan disseminate. Pengembangan ini hanya sampai pada tahap develop karena hasil pengembangan tidak disosialisasikan ke sekolah. Validasi dilakukan oleh ahli. Uji coba dilakukan oleh siswa. Uji coba lapangan terbatas dilakukan di SMA Negeri 1 Dampit yang melibatkan 15 siswa. Hasil pengembangan adalah media interaktif , yang terdiri dari bagian pra pembuka, pembuka, isi, serta penutup dan website, yang terdiri dari home, materi, shout box, bulletin board, kontak, serta petunjuk. Hasil dari validasi oleh para ahli adalah kelayakan adalah kelayakan media Hybrid Learning untuk komponen isi, kebahasaan, dan penyajian masing-masing adalah 3,4 (89,9%); 3,5 (88,8%); dan 3,5 (88,8%). Efektivitas media Hybrid Learning dilihat dari hasil belajar yang diperoleh dari siswa dalam uji coba lapangan terbatas. Rata-rata hasil belajar siswa tersebut adalah 83,50 berbeda dengan rata-rata hasil belajar siswa tersebut sebelum menggunakan media Hybrid Learning pada materi hidrokarbon, yaitu sebesar 70,00. Perbedaan ini ditunjukkan oleh hasil uji t-dua ujung (thitung = 11,37) yang lebih besar dari ttabel¬ (4,30). Ketuntasan belajar siswa yang menggunakan media Hybrid Learning adalah 100%, atau tidak satu pun siswa yang tidak tuntas belajar.

Penggunaan learning assignment-inquiry berbantuan software geogebra untuk mengefektifkan pembelajaran grafik fungsi trigonometri di SMK Negeri 1 Singosari / Agus Triedi

 

Program Studi Pendidikan Matematika, Program Pascasarjana, Universitas Negeri Malang. Pembimbing: (1) Dr. Cholis Sa’dijah, M.Pd., M.A., (2) Dr. rer. nat I Made Sulandra, M.Si. Kata Kunci : Learning Assignment - Inquiry, Software Geogebra, Pembelajaran Efektif, Grafik Fungsi Trigonometri. Pertanyaan penelitian ini adalah “Bagaimanakah pembelajaran grafik fungsi trigonometri yang efektif menggunakan Learning Assignment - Inquiry berbantuan Software Geogebra di SMK Negeri 1 Singosari?”. Sejalan dengan pertanyaan penelitian, maka penelitian ini bertujuan untuk memperoleh deskripsi pembelajaran grafik fungsi trigonometri yang efektif menggunakan Learning Assignment-Inquiry berbantuan Software Geogebra di SMK Negeri 1 Singosari. Penelitian ini menggunakan pendekatan kualitatif dengan rancangan penelitian tindakan kelas. Penelitian dilaksanakan pada siswa kelas XI OTR-2 SMK Negeri 1 Singosari. Hasil Penelitian diperoleh informasi bahwa efektifitas penggunaan Learning Assignment – Inquiry berbantuan Software Geogebra dalam pembelajaran grafik fungsi trigonometri ditunjukkan dengan hasil: (1) ketuntasan belajar siswa sangat baik (97%), (2) aktivitas guru dalam kategori sangat baik (93%), (3) aktivitas siswa dalam kategori baik (89%), dan (4) respon siswa dalam kategori sangat baik (91%). Hasil penelitian menunjukkan bahwa penggunaan Learning Assignment – Inquiry berbantuan Software Geogebra mengefektifkan pembelajaran grafik fungsi trigonometri di SMK Negeri 1 Singosari. Pembelajaran yang efektif memiliki karakteristik: (1) perencanaan perangkat pembelajaran yang valid, (2) aktivitas guru dalam melakukan proses pembelajaran sesuai dengan perencanaan, (3) siswa aktif berpartisipasi, berkolaborasi, bertanya kepada teman maupun guru dan menyampaikan argumentasi, (4) siswa mampu melakukan investigasi dan kontruksi pengetahuan, (5) respon siswa baik, dan (6) diperoleh ketuntasan belajar minimal 85% dari seluruh siswa. Berdasarkan penelitian ini, disarankan agar peneliti lain yang berminat mengadakan penelitian serupa hendaknya melakukan pada sekolah lain atau materi lain, sehingga diperoleh gambaran lebih lanjut mengenai efektifitas pembelajaran dengan menggunakan Learning Assignment – Inquiry berbantuan Software Geogebra. Bagi guru matematika disarankan untuk menerapkan pembelajaran menggunakan Learning Assignment – Inquiry berbantuan Software Geogebra pada pokok bahasan lain dengan karakteristik yang sama.

Perbedaan efektivitas penambangan pasir sungai di kecamatan Ngantru Kabupaten Tulungagung / Wida Yanti

 

Kata Kunci: Efektivitas, Kondisi geografis, Aktivitas, Hasil, Penambang pasir sungai. Prinsip diferensiasi area menyatakan bahwa tiap lokasi memiliki karakteristik tertentu yang tidak sama dengan lokasi lainnya, akibatnya akan menimbulkan fenomena yang berbeda pula antara lokasi yang satu dengan lokasi yang lainnya. Adanya perbedaan karakteristik lokasi penambangan pasir tersebut mempengaruhi efektivitas penambangan tiap lokasi penambangan terutama pada aktivitas dan hasil penambangan pasir tiap lokasi penambangan. Penelitian ini dilaksanakan dengan tujuan untuk: (1) mendeskripsikan karakteristik kondisi geografis lokasi penambangan pasir sungai di Desa Batokan dan Desa Pinggirsari, (2) mendeskripsikan aktivitas penambangan pasir sungai di Desa Batokan dan Desa Pinggirsari, (3) menganalisis perbedaan hasil penambangan pasir sungai di Desa Batokan dan Desa Pinggirsari, dan (4) menganalisis perbedaan efektivitas penambangan pasir sungai di Kecamatan Ngantru Kabupaten Tulungagung. Penelitian ini merupakan penelitian deskriptif kuantitatif dengan menggunakan 33 responden yang tersebar sebanyak 10 responden di Desa Batokan dan 23 responden di Desa Pinggirsari. Penelitian ini menggunakan angket sebagai alat pengumpul data. Pengambilan data menggunakan 3 metode yaitu: observasi, dokumentasi dan angket. Analisis data yang digunakan dalam penelitian ini adalah Uji Normalitas dengan menggunakan Kolmogorov-Smirnov serta Uji Statistik dengan menggunakan Uji t Sampel Tidak Berpasangan. Berdasarkan hasil penelitian tersebut diperoleh empat kesimpulan penelitian sebagai berikut: (1) kondisi geografis lokasi penambangan di Desa Pinggirsari lebih efektif daripada lokasi penambangan Desa Batokan karena jarak rumah penambang ke lokasi penambangan di Desa Pinggirsari lebih dekat dari pada jarak rumah penambang Desa Batokan ke lokasi penambangan, topografi lokasi penambangan dan relief menuju lokasi penambangan di Desa Pinggirsari relatif lebih datar dibandingkan dengan lokasi penambangan Desa Batokan dan aksesibilitas menuju lokasi penambangan Desa Pinggirsari lebih tinggi dan lebih mudah dicapai daripada Desa Batokan, (2) aktivitas penambangan di Desa Batokan dan Desa Pinggirsari berbeda pada jam kerja penambangan, dimana jam kerja di Desa Batokan lebih lama daripada jam kerja penambang di Desa Pinggirsari, (3) perbedaan hasil penambangan antara Desa Batokan dan Desa Pinggirsari terjadi karena adanya penarikan retribusi di lokasi penambangan Desa Batokan, (4) berdasarkan kondisi geografis lokasi penambangan, aktivitas penambangan dan hasil penambangan lokasi penambangan pasir sungai di Desa Pinggirsari lebih efektif daripada lokasi penambangan pasir sungai di Desa Batokan.

Hubungan antara kontrol diri dengan agresi pada anggota kepolisian samapta Resor Pasuruan / Ligrinda Ambaranis

 

Kata Kunci : kontrol diri, agresi, satuan pengamanan patroli kota (SAMAPTA). Samapta adalah salah satu fungsi kepolisian yang memiliki berbagai fungsi bagian. Agresifitas yang dimiliki anggota Samapta bisa dipengaruhi oleh faktor budaya, faktor biologi, atau faktor-faktor yang lain ( Klopfer & Davidson, 1962). Salah satu ciri-ciri yang paling menonjol pada seorang Samapta adalah sifat agresi terutama dalam menghadapi unjuk rasa masa yang tidak tertib. Secara Umum seorang Samapta memiliki sifat sangat agresif. Tujuan utama penelitian ini adalah untuk mengetahui: (1) kontrol diri anggota Samapta, (2) agresi anggota Samapta, (3) Hubungan Kontrol Diri dan Agresi Pada Anggota Samapta kepolisian Polres Pasuruan. Hipotesa dalam penelitian ini adalah ada hubungan antara control diri dan agresi anggota Samapta kepolisian resor Pasuruan. Desain yang digunakan adalah deskriptif korelasional dengan teknik uji coba terpakai dengan menggunakan skala kontrol diri dan skala agresi. Subyek penelitian adalah anggota samapta Kepolisian Resor Kabupaten Pasuruan yang berjumlah 38 orang. Data yang terkumpul dianalisa dengan teknik korelasi Pearson. Hasil penelitian menunjukkan bahwa: (1) kontrol diri anggota Samapta berada pada tingkatan sedang sebanyak 49,5%, (2) agresi anggota Samapta berada pada tingkatan sedang sebanyak 55,2% , (3) ;H1:Terdapat Hubungan Kontrol Diri dengan Agresi Pada Anggota Samapta kepolisian resor Pasuruan (DITERIMA) Berdasarkan hasil penelitian ini dapat disarankan bagi Kepolisian Resor Pasuruan, hendaknya pihak Kepolisian Resor Pasuruan lebih memperhatikan kondisi psikologis para anggotanya terutama terhadap anggota – anggota yang sedang mengalamai masalah pribadi maupun karir, agar tidak terjadi agresi berlebihan yang dapat merugikan orang lain. Bagi peneliti selanjutnya, denagan adanya keterbatasan baik pada peneliti maupun pada penelitian ini, maka diharapkan dilakukan penelitian untuk menyempurnakan penelitian ini dengan memperhatikan faktor – faktor lain yang ikut berpengaruh, seperti pertimbangan pemilihan subjek penelitian supaya hasil penelitian dapat digeneralisasikan pada populasi yang lebih luas.

Pengaruh kepercayaan merek terhadap loyalitas konsumen dalam membeli produk Pond's (studi pada mahasiswa Fakultas Ekonomi Universitas Negeri Malang) / Karomatul Islamiyah

 

Kata Kunci: Kepercayaan Merek, Loyalitas Konsumen Pond’s merupakan produk kecantikan yang sudah mempunyai nama besar. Namun dalam kondisi persaingan yang semakin ketat, perusahaan harus mampu mempertahankan konsumennya. Dalam upaya mempertahankan konsumennya dibutuhkan kepercayaan merek yang tinggi, karena melalui kepercayaan merek akan dapat membuat konsumennya terus loyal terhadap produk Pond’s. Tujuan dari penelitian ini adalah untuk mengetahui kondisi kepercayaan merek dan loyalitas konsumen terhadap produk kecantikan merek Pond’s di Fakultas Ekonomi Universitas Negeri Malang, serta variabel kepercayaan merek yang mempengaruhi loyalitas konsumen. Penelitian ini mempunyai dua variabel yaitu variabel bebas (X) dan variabel terikat (Y). Variabel bebas (X) yang terdiri dari brand reliability (X1)dan brand intention (X2), sedangkan variabel terikatnya (Y) adalah loyalitas konsumen. Penelitian ini merupakan penelitian asosiatif dengan pendekatan kuantitatif. Penelitian ini berusaha menjelaskan pengaruh sub variabel kepercayaan merek secara parsial maupun secara simultan terhadap loyalitas konsumen dalam membeli produk Pond’s di Fakultas Ekonomi Universitas Negeri Malang. Populasi dalam penelitian ini adalah mahasiswa Fakultas Ekonomi Universitas Negeri Malang yang menjadi konsumen produk Pond’s. Sedangkan sampel sebanyak 110 responden dengan menggunakan teknik purposive sampling. Berdasarkan hasil analisis data, diperoleh empat kesimpulan hasil penelitian sebagai berikut. Pertama, mahasiswa Fakultas Ekonomi Universitas Negeri Malang memiliki kepercayaan merek (brand reliability dan brand intention) yang tinggi dan loyalitas konsumen yang tinggi dalam membeli produk Pond’s. Kedua, brand reliability secara parsial berpengaruh positif dan signifikan terhadap loyalitas konsumen dalam membeli produk Pond’s dan intention secara parsial berpengaruh positif dan signifikan terhadap loyalitas konsumen dalam membeli produk Pond’s. Ketiga, kepercayaan merek (brand reliability dan brand intention) berpengaruh positif dan signifikan secara simultan terhadap loyalitas konsumen dalam membeli produk Pond’s. Keempat, sub variabel kepercayaan merek yang dominan mempengaruhi loyalitas konsumen dalam membeli produk Pond’s adalah brand reliability. Saran yang direkomendasikan terkait hasil penelitian yang didapatkan adalah, (1) Pihak PT. Unilever selaku pihak yang mengeluarkan produk Pond’s sebaiknya terus meningkatkan tampilan iklan di Tv yang lebih menarik lagi dengan cara menampilkan public figure yang terkenal ataupun dengan inovasi latar cerita yang menonjolkan keunggulan Pond’s agar dapat semakin meningkatkan kepercayaan merek konsumennya. Selain itu, dari sumbangan efektif menunjukkan bahwa niatan merek Pond’s kurang dominan sehingga PT. Unilever harus mengkaji lagi bukti konkrit yang diterima oleh konsumen bukan hanya berupa niatan agar konsumen tidak kecewa. (2) Peneliti menyarankan dalam penelitian selanjutnya, objek penelitian yang diambil lebih baik yaitu masyarakat umum dari berbagai golongan usia, dan tempat penelitian yang lebih luas supaya data penelitian diperoleh lebih valid agar variabel yang diteliti lebih tereksplorasi. Selain itu, peneliti selanjutnya disarankan menambah jumlah variabel penelitian yang dapat mempengaruhi loyalitas konsumen selain variabel yang diteliti saat ini seperti atribut produk, threat emotion, involvement dan kepuasan konsumen.

Perbedaan hasil belajar siswa yang dibelajarkan dengan menggunakan metode injuiri terbimbing dan metode konvensional pada materi larutan elektrolit dan nonelektrolit kelas X SMA Laboratorium UM tahun ajaran 2009/2010 / Sri Wahyuni

 

Kata Kunci: Inkuiriterbimbing, hasilbelajar, persepsisiswa Salah satu upaya untuk memperbaiki kualitas pendidikan yaitu dengan adanya perubahan orientasi pembelajaran dari belajar yang berpusat pada guru (behavioristik) menjadiberpusat pada siswa (konstruktivistik). Salah satu pendekatan pembelajaran yang melibatkan siswa dalam menemukan konsep yaitu pembelajaran dengan metode inkuiri terbimbing.Pada pembelajaran dengan metode inkuiri terbimbing siswa dilibatkan secara aktif dalam menemukan konsep dasar, sehingga siswa lebih mudah memahami konsep tersebut dan ingatan siswa terhadap konsep tersebut akan bertahan lebih lama. Tujuan dari penelitian adalah untuk mengetahui: (1) perbedaan hasil belajar antara siswa yang diajar dengan menggunakan metode inkuiri terbimbing dengan metode konvensional pada materi Larutan Elektrolit dan Nonelektrolit, dan(2) persepsi siswa terhadap penggunaan metode pembelajaran inkuiri terbimbing dalam materiLarutan Elektrolit dan Nonelektrolit. Penelitian yang dilakukan menggunakan rancangan ekperimen semu dan deskriptif. Populasi penelitian adalah siswa kelas X SMA Lab. UM. Sampel didapatkan dengan teknik Cluster Random Sampling hingga diperoleh bahwa kelas X-3 yang diajarkandenganmetodeinkuiriterbimbingdan kelas X-5yang diajarkandenganmetodekonvensional. Instrumen yang digunakan adalah instrumen perlakuan berupa RPPdan LKS dan instrumen pengukuran berupa lembar observasi, angket, dan soal hasil belajar. Data hasil belajar dianalisismenggunakan uji tdenganbantuan program SPSS 16.0 for windows. Hasil penelitian menunjukkan bahwa: (1) Ada perbedaan hasil belajar siswa yang diajar dengan metode pembelajaran inkuiri terbimbing dengan siswa yang diajardenganmetodekonvensional dengan nilai rata-rata 83,19 untuk kelas inkuiri terbimbing dan 74,56 untuk kelas konvensional, (2)Persepsi siswa terhadap pembelajaran dengan metode inkuiri terbimbing menunjukkan 32% siswa merespon sangat positif, 55% siswa merespon positif, dan 13% siswa merespon sangat negatif. Hal tersebut mengindikasikan pembelajaran dengan metode inkuiri terbimbing dapat diterima siswa dengan baik.

Penerapan pembelajaran berbasis inkuiri dengan model the 5 e learning cycle untuk meningkatkan keaktifan belajar dan hasil belajar IPA siswa kelas VII-E SMP Negeri 1 Singosari Kabupaten Malang tahun pelajaran 2009/2010 / Rudi Purnomo

 

Program Studi Pendidikan Dasar Konsentrasi Pendidikan IPA SMP, Program Pasca Sarjana, Universitas Negeri Malang. Pembimbing (I) Dr. Lia Yuliati, M.Pd,Pembimbing (II) Prof. Suhadi Ibnu, MA.Ph.D. Kata kunci :Inkuiri, model The 5E Learning Cycle, keaktifan belajar, hasil belajar Hasil observasi awal di SMP Negeri 1 Singosari diperoleh bahwa siswa cenderung pasif dan kurang aktif. Pembelajaran cenderung menekankan pada hafalan-hafalan saja. Tujuan penelitian ini adalah untuk meningkatkan keaktifan belajar siswa dan hasil belajar IPA (fisika) siswa kelas VII-E SMP Negeri 1 Singosari tahun pelajaran 2009/2010 dengan jumlah siswa 31. Penelitian ini merupakan penelitian tindakan kelas yang dilakukan dalam dua siklus yang meliputi empat tahap yaitu perencanaan, tindakan/observasi, evaluasi, dan refleksi. Keaktifan siswa diperoleh dari data keterlibatan mereka dalam keberanian bertanya, keberanian mengemukakan pendapat, dan keberanian mempertanyakan gagasan saat pembelajaran. Hasil belajar meliputi aspek keterampilan belajar, aspek psikomotorik dan aspek kognitif yang dipeoleh dari evaluasi (tes) kepada siswa. Metode pengumpulan data yang digunakan adalah data dari hasil belajar siswa diperoleh dari pemberian tes tertulis kepada siswa, penilaian keterampilan belajar dan psikomotorik diperoleh dari pengamatan melalui lembar observasi, data analisis kuesioner diperoleh melalui lembar kuesioner. Dari hasil penelitian diperoleh, keaktifan saat pembelajaran fisika, dimana dari data keterlaksaan oleh guru pada siklus I sebesar 71,56% meningkat pada siklus II sebesar 91,57%. Persentase rata-rata keterlaksanaan tahap pembelajaran oleh siswa pada siklus I sebesar 75,25% meningkat pada siklus II sebesar 90,19%. Pada siklus I rerata pencapaian keaktifan belajar pada ketiga indikator untuk semua siswa pada siklus pertama adalah 24,4 % dan terjadi peningkatan pada siklus ke II sebesar 37,3%. Rerata tertinggi adalah pada indikator keberanian bertanya yaitu pada siklus I sebesar 1,4% meningkat di siklus II menjadi 2,2%, keberanian mengemukakan pendapat,pada siklus I sebesar 0,7% menjadi meningkat di siklus II sebesar 1,2% dan rerata terendah adalah indikator mempertanyakan gagasan orang lain yaitu hanya 0,2 % di siklus I menjadi meningkat di Siklus II sebesar 0,3%. Pada siklus I rata-rata nilai tes siswa 75 dengan ketuntasan belajar klasikal 80%; siklus II nilai rata-rata siswa 85,45 dengan ketuntasan belajar klasikal 83,3%. Hasil belajar psikomotorik pada siklus I siswa secara klasikal mencapai ketuntasan 34,74% menjadi 69,06% pada siklus II. Hasil belajar aspek keterampilan belajar pada siklus I siswa secara klasikal mencapai ketuntasan 29,80% menjadi 59,20% pada siklus II. Selanjutanya pada siklus I diperoleh 40% siswa sudah mampu mencapai tingkatan kognitif penerapan (C3), namun pada siklus II siswa sudah mampu sampai pada tingkatan analisis (C4), hal ini menunjukan peningkatan belajar yang lebih baik dari pada di siklus I. Hal ini dapat disimpulkan bahwa penerapan pembelajaran inkuiri dengan model The 5E Learning Cycle dapat meningkatkan keaktifan belajar dan hasil belajar IPA siswa materi pokok Kalor pada kelas VII-E SMP Negeri 1 Singosari Malang tahun ajaran 2009/2010.

Pengaruh suhu sintering dan ukuran partikel terhadap mikrostruktur dan kuat tekan keramik porselen / Ika Setyawati

 

Kata kunci: porselen, suhu sintering, ukuran partikel, kuat tekan, mikrostruktur Pada umumnya, porselen dipanaskan sampai suhu 1350°C atau 1400°C, bahkan ada yang lebih tinggi lagi hingga mencapai 1500°C. Porselen yang tampaknya tipis dan rapuh sebenarnya mempunyai kekuatan karena struktur dan teksturnya rapat serta keras seperti gelas. Oleh karena keramik ini dibakar pada suhu tinggi maka dalam bodi porselen terjadi penggelasan atau vitrifikasi. Secara teknis keramik jenis ini mempunyai kualitas tinggi sedangkan pada penelitian ini menggunakan pemanasan pada suhu rendah. Karena ada bahan tambahan yang disebut frit, yang bisa membuat keramik ini tetap kuat walaupun dengan suhu rendah. Dengan pembakaran suhu rendah tersebut akan mempengaruhi biaya produksi sehingga menjadi lebih murah. Penelitian ini bertujuan untuk mengetahui pengaruh suhu sintering dan ukuran partikel terhadap mikrostruktur keramik porselen. Selain itu akan dilihat kuat tekan keramik porselen yang dipengaruhi oleh suhu dan ukuran partikel. Penelitian ini memvariasi suhu sintering, yaitu 1050°C, 1100°C, 1150°C, 1200°C, 1250°C dan memvariasi ukuran partikel antara lain 80 mesh, 100 mesh, dan 200 mesh, masing-masing disintering dengan lama penahanan 6 jam dan tiap variasi dibuat 3 sampel. Tahap selanjutnya pengujian kuat tekan dengan menggunakan set uji kuat tekan dan melihat mikrostruktur dengan menggunakan alat SEM. Hasil penelitian ini menunjukkan bahwa :(1) suhu sintering mempengaruhi mikrostruktur keramik porselen. Proses sintering menyebabkan butiran-butiran partikel-partikel bersebelahan bereaksi dan berikatan. Pada pembakaran yang lebih tinggi bahan-bahan pelebur akan mulai melebur dan menutup sebagian pori-pori. Suhu sintering yang semakin meningkat menyebabkan ukuran butiran lebih merata dan sedikit pori. (2) suhu sintering meningkatkan kuat tekan keramik porselen. Pada suhu sintering yang semakin tinggi kuat tekan cenderung semakin tinggi pula, yaitu pada rentang suhu 1050°C - 1200°C. Kuat tekan tertinggi pada suhu 1200°C dengan nilai kuat tekannya 69,87 MPa. (3) ukuran partikel mempengaruhi mikrostruktur keramik porselen. Dengan ukuran butir yang lebih kecil, maka makin sedikit ruang yang kosong yang terdapat diantara butir sehingga mikrostruktur tampak lebih bagus yang maliputi ukuran butir yang merata, sedikit pori, antar partikel sudah beraglomerasi sehingga mempengaruhi kuat tekan menjadi besar. (4) ukuran partikel meningkatkan kuat tekan keramik porselen. Semakin kecil ukuran partikel maka kuat tekan juga semakin tinggi.Kuat tekan tertinggi pada ukuran partikel 200 mesh.

Pengaruh persepsi siswa tentang perpustakaan sekolah dan profesionalisme guru terhadap prestasi belajar akuntansi siswa SMA Negeri 1 Singosari Malang / Erma Damayanti

 

Kata Kunci: Perpustakaan Sekolah, Profesionalisme Guru, Prestasi Belajar Akuntansi. Perpustakaan sekolah adalah sebuah ruangan atau gedung yang digunakan untuk menyimpan buku dan terbitan lainnya yang biasanya disimpan menurut tata susunan tertentu yang digunakan pembaca bukan untuk dijual. Tujuan perpstakaan sekolah salah satunya adalah harus digunakan oleh pemakainya. Pemakai tersebut antarqa lain guru dan siswa. Profesionalisme guru adalah pekerjaan atau kegiatan yang dilakukan oleh seseorang dan menjadi sumber penghasilan kehidupan yang memerlukan keahlian, kemahiran, atau kecakapan yang memenuhi standar mutu atau norma tertentu serta memerlukan pendidikan profesi sehingga dapat meningkatkan prestasi belajar siswa. Tujuan Penelitian adalah untuk mengetahui pengaruh: (1) untuk mengetahui pengaruh perpustakaan sekolah terhadap prestasi belajar akuntansi siswa, (2) untuk mengetahui pengaruh profesionalisme guru terhadap prestasi belajar akuntansi siswa. Populasi penelitian ini adalah siswa kelas XII IPS SMA Negeri 1 Singosari yaitu sebanyak 76 siswa. Teknik pengambilan sampel adalah teknik (random sampling) sehingga diperoleh sampel berjumlah 39 siswa. Variabel bebas dalam penelitian ini adalah perpustakaan sekolah(X1), profesionalisme guru (X2), dan variabel terikatnya prestasi belajar akuntansi (Y). Teknik pengumpulan data yang digunakan dalam penelitian ini adalah kuesioner dan dokumentasi. Metode analisis data menggunakan analisis regresi linier berganda. Hasil penelitian yang diperoleh: (1) tidak terdapat pengaruh perputakaan sekolah terhadap prestasi belajar akuntansi siswa SMA Negeri 1 Singosari sebesar 2,002, (2) tidak terdapat pengaruh profesonalisme guru terhadap prestasi belajar akuntansi siswa SMA Negeri 1 Singosari sebesar 2,002, (3) tidak terdapat pengaruh perpustakaan sekolah dan profesionalisme guru terhadap prestasi belajar akuntansi siswa SMA Negeri 1 Singosari sebesar 0,833. Disarankan: (1) Bagi kepala sekolah hendaknya menunjuk salah satu guru atau pegawai sebagai penanggung jawab perpustakaan, serta melakukan pembenahan perpustakaan sekolah, (2) Bagi guru diharapkan dapat melakukan komunikasi secara efektif dengan siswa sehingga dapat meningkatkan prestasi siswa, (3) Bagi siswa yang prestasi belajar tidak baik diharapkan berusaha meningkatkan prestasi belajar dengan memanfaatkan fasilitas sekolah terutama perpustakaan sekolah dan mengikuti kegitan belajar mengajar dengan baik, (4) penelitian selanjutnya hendaknya jumlah sampel dan populasi dikembangkan, selain itu pengumpulan data hanya berupa angket dan dokumentasi sebaiknya dikembangkan berupa observasi dan wawancara dengan siswa.

Pengaruh atmosfir toko (Store atmosphere) terhadap keputusan pembelian buku text book (Studi pada konsumen toko buku Toga Mas Malang) / Ferry Indra L.

 

Kata Kunci: Atmosfir Toko, Keputusan Pembelian Konsumen. Kota Malang merupakan kota yang mendapat julukan sebagai kota pendidikan atau kota pelajar. Kota ini mendapat julukan tersebut, karena terdapat banyak perguruan tinggi baik perguruan tinggi negeri maupun swasta, selain itu banyak mahasiswa yang berasal dari luar kota Malang. Keberadaan kota Malang sebagai kota pendidikan didukung oleh beberapa fasilitas pendidikan salah satunya adalah toko buku. Berbicara masalah toko buku, perkembangan toko buku di Indonesia cukup menggembirakan, tampak disetiap sudut kota banyak kita temukan toko buku khususnya di kota Malang. Keberadaan toko buku di kota Malang sangat disambut baik oleh pelajar, sehingga peritel harus mampu bersaing di pasar mereka untuk merebut hati konsumennya. Untuk dapat bertahan dan memenangkan persaingan, setiap retailer dituntut untuk mengembangkan usaha pemasaran yang inovatif pada bisnis ecerannya guna menarik para konsumen untuk mengunjungi tokonya, setelah itu konsumen diharapkan melakukan pembelian, sehinggga omset penjualan akan naik, dengan omset penjualan naik maka pendapatan akan naik dan berakibat aliran laba (profit flow) akan lancar. Untuk dapat menarik konsumen agar melakukan pembelian, salah satunya dapat dilakukan dengan kreatifitas penciptaan suasana (Atmosphere) yang menyenangkan dan menarik di dalam toko, karena dewasa ini ada kecenderungan berubahnya motif seseorang untuk berbelanja, dimana kegiatan berbelanja tidak hanya sebagai kegiatan fungsional untuk membeli barang kebutuhan saja, tetapi juga kegiatan untuk rekreasi, hiburan atau hanya untuk pelepas stress. Artinya, saat konsumen masuk ke sebuah toko, mereka tidak hanya memberikan penilaian terhadap produk yang ditawarkan retailer tetapi juga akan memberikan penilaian terhadap kreatifitas penciptaan suasana pada toko tersebut. Berdasarkan penjelasan diatas maka peneliti tertarik melakukan penelitian tentang Atmosfir Toko. Penelitian ini bertujuan untuk pengaruh Atmosfir Toko (yang terdiri atas faktor desain toko, faktor sosial dan faktor ambien toko) secara parsial terhadap keputusan pembelian konsumen Toko Buku Toga Mas Malang. Dalam penelitian ini teknik pengambilan sampel yang digunakan Accidental Sampling yaitu menentukan sampel berdasarkan kebetulan, dimana jumlah sampel yang diambil sebanyak 138 orang konsumen Toko Buku Toga Mas Malang dengan menggunakan rumus Umar. Skala yang digunakan adalah Skala Likert dengan 5 (lima) opsi pilihan jawaban. Untuk menguji kelayakan instrumen digunakan uji validitas dan reliabilitas. Teknik pengumpulan data dalam penelitian ini menggunakan kuesioner, dokumentasi, observasi dan wawancara. Penelitian ini menggunakan teknik analisis deskriptif dan analisis regresi linear berganda dengan menggunakan SPSS Versi 12.00. Berdasarkan hasil penelitian diketahui bahwa variabel Terdapat pengaruh positif yang signifikan Atmosfir Toko (yang terdiri atas Faktor Desain Toko, Faktor Sosial dan Faktor Ambien Toko) secara parsial terhadap Keputusan Pembelian Konsumen. Hal ini ditunjukkan dengan nilai signifikansi t = 3,294 < 0,05 untuk Faktor Desain Toko, nilai signifikansi t = 0,006 < 0,05 untuk Faktor Sosial, dan Signifikansi t = 0,001 < 0,05 untuk faktor Ambien Toko. Terdapat pengaruh positif yang signifikan Atmosfir Toko (yang terdiri atas Faktor Desain Toko, Faktor Sosial dan Faktor Ambien Toko) secara simultan terhadap Keputusan Pembelian Konsumen. Hal ini ditunjukkan dengan nilai signifikansi sebesar F = 0,000 lebih kecil dari nilai  = 0,05. Dari hasil penelitian diketahui faktor ambien merupakan faktor dominan dari atmosfir toko yang mempengaruhi keputusan pembelian konsumen di Toko Buku Toga Mas Malang.

Peningkatan aktivitas dan hasil belajar seni tari melalui pembelajaran kooperatif dengan metode group investigation (GI) pada kelas X H SMA Negeri 1 Pamekasan tahun pelajaran 2009/2010 / Femi Souvranita Hayuningtias

 

Kata kunci: keterampilan praktek seni tari, kooperatif, group investigation (GI). Proses kegiatan belajar mengajar mata pelajaran praktek seni tari di kelas X H SMA Negeri I Pamekasan lebih banyak didominasi oleh guru, dengan demikian guru lebih aktif daripada siswa. Dari bentuk pembelajaran secara konvensional ini membuat hasil belajar siswa dalam ketrampilan praktek tari rendah. Untuk meningkatkan kualitas pembelajaran praktek seni tari di kelas X H SMA Negeri 1 Pamekasan, diperlukan pembaharuan dalam proses belajar mengajar hasil belajar siswa dalam praktek seni tari lebih meningkat. Salah satu pembaharuan dalam proses belajar mengajar keterampilan praktek tari sebagai bentuk pembelajaran yang inovatif bagi guru dalam pemberian materi praktek seni tari adalah model pembelajaran kooperatif dengan metode Group Investigation (GI). Tujuan penelitian ini untuk meningkatkan aktivitas dan hasil belajar praktek tari melalui model pembelajaran kooperatif dengan metode Group Investigation (GI). Dengan penerapan model pembelajaran tersebut pada pelajaran praktek seni tari, maka akan diketahui bagaimana aktivitas dan hasil belajar siswa dengan model pembelajaran kooperatif dengan metode Group Investigation (GI) pada mata pelajaran praktek seni tari. Penelitian ini dilaksanakan di SMA Negeri 1 Pamekasan kelas X H yang banyaknya 36 orang siswa. Jenis penelitian ini adalah penelitian deskriptif kualitatif dengan menggunakan rancangan Penelitian Tindakan Kelas dengan dua siklus. Siklus pertama diselesaikan dalam 6 pertemuan dengan pembagian kelompok yang bersifat heterogen berdasarkan kemampuan siswa. Sedangkan siklus kedua diselesaikan dalam 6 pertemuan dengan pembagian kelompok yang bersifat heterogen berdasarkan jenis kelamin siswa. Hasil penelitian dan pembahasan dapat diketahui bahwa hasil belajar pada keterampilan praktek tari pada siklus I siswa yang mencapai ketuntasan sebanyak 16 siswa dari 36 siswa. Sedangkan hasil tes kemampuan siswa pada siklus II, melalui pembelajaran kooperatif metode Group Investigation (GI) kualitas pembelajaran keterampilan praktek seni tari siswa kelas X H SMA Negeri I pamekasan lebih meningkat dengan hasil yang memuaskan. Dengan jumlah siswa yang mengalami ketuntasan sebanyak 32 orang dari 36 siswa. Guru seni tari SMA, hendaknya mencoba atau membiasakan diri selama pemberian mata pelajaran seni tari menggunakan model pembelajaran kooperatif metode GI (Group Investigation). Hal ini karena pembelajaran kooperatif metode GI (Group Investigation) mampu memberikan pengembangan kegembiraan belajar yang sejati dan sekaligus sebagai acuan bagi perkembangan kepribadian yang sehat antar siswa.

Pengembangan model pembelajaran naval collaboration flexible learning (NCFL) aplikasi pada bidang studi psikologi massa di Akademi Angkatan Laut / Adi Bandono

 

Program Studi Teknologi Pembelajaran, Program Pascasarjana, Universitas Negeri Malang. Pembimbing: (I) Prof. Dr. I. Nyoman Sudana Degeng, (II) Prof. Dr. I. Wayan Ardhana, (III) Prof. Dr. H.M. Dimyati. Kata Kunci: Model Pembelajaran, Model Pengembangan Pembelajaran, Model Pembelajaran Naval Collaboration Flexible Learning (NCFL). Ada tiga alasan utama yang mendasari pentingnya pengembangan model pembelajaran Naval Collaboration Flexible Learning (NCFL) di Akademi Angkatan Laut, yaitu: (1) Tuntutan penugasan awal di Satuan bagi prajurit TNI Angkatan Laut, membutuhkan Perwira yang memiliki kompetensi kepemimpinan yang humanis, salah satunya adalah kemampuan kolaborasi yang sejak dini perlu ditumbuhkembangkan melalui proses pembelajaran. (2) Akademi Angkatan Laut telah memiliki learning resources yang cukup lengkap dan bervariasi termasuk fasilitas laboratorium berbasis ICT (Information Communication and Technology) yang dapat dikelola secara fleksibel untuk mendukung hasil pembelajaran yang berkualitas, namun sampai saat ini pemanfaatan dan pendayagunaannya dirasakan kurang optimal. (3) Dalam praktek pembelajaran ternyata masih banyak Gadik Akademi Angkatan Laut yang belum melaksanakan analisis kondisi pembelajaran, belum merumuskan dan menetapkan hasil pembelajaran yang diharapkan, sehingga berpengaruh pada pemilihan dan penetapan metode pembelajaran yang kurang tepat. Tujuan penelitian pengembangan ini adalah untuk menghasilkan sebuah model dalam konteks pembelajaran yang disebut dengan Model pembelajaran NCFL. Model pembelajaran NCFL dibangun dengan menggunakan pendekatan filosofis Pancasila, kultur TNI Angkatan Laut, teori sistem, teori komunikasi dan teori belajar dan pembelajaran yang mendukung kolaborasi. Model pembelajaran NCFL membangun sistem sosial berbasis kolaborasi dan dikembangkan untuk mencapai dampak pembelajaran guna mengoptimalkan penguasaan materi bidang studi tertentu (Psikologi Massa) dan kompetensi kolaborasi Kadet Akademi Angkatan Laut. Model pembelajaran NCFL dikembangkan dengan tahapan dan langkah pengembangan, sebagai berikut: (1) Tahap Analisis, meliputi: pembentukan tim partisipasi dan analisis kondisi (analisis kebutuhan, analisis tujuan pembelajaran dan karakteristik bidang studi, analisis sumber belajar, analisis karakteristik pebelajar). (2) Tahap Disain dan Pengembangan, terdiri dari: penetapan strategi pembelajaran (pengorganisasian, penyampaian, pengelolaan dan penilaian), sistem pendukung dan produksi disain, sampai dengan menghasilkan prototipe model awal. (3) Tahap Evaluasi, dengan melakukan ujicoba ahli, ujicoba individu, ujicoba kelompok dan ujicoba lapangan untuk menghasilkan model final sebagaimana yang diharapkan. Subyek ujicoba lapangan adalah Kadet Akademi Angkatan Laut tingkat III S2 (Kelas B) yang menempuh bidang studi Psikologi Massa. Instrumen pengumpulan data dan teknik analisis dilakukan secara kualitatif untuk mendukung karakteristik model pembelajaran yang memungkinkan terhadap perbaikan. Berdasarkan analisis data, dapat diambil simpulan sebagai berikut: (1) Model pembelajaran NCFL telah menghasilkan dampak pembelajaran sebagaimana yang diharapkan. Sintaks model pembelajaran telah berjalan secara efektif dan hasilnya layak diaplikasikan dalam praktek pembelajaran. Model pembelajaran NCFL memiliki landasan teoritis yang cukup kuat, dan telah melalui proses pengembangan yang dapat dipertanggungjawabkan secara ilmiah. (2) Model pembelajaran NCFL memberikan penekanan penting pada: strategi pengorganisasian isi telah diorganisasi dengan menggunakan prinsip-prinsip elaborasi dan disain pesan yang efektif sehingga konsep yang rumit menjadi lebih mudah dipahami, strategi penyampaian mengaplikasikan prinsip-prinsip kolaborasi dan berbasis pengalaman nyata sehingga pebelajar memiliki kompetensi kolaborasi dan pengalaman nyata, strategi pengelolaan mengaplikasikan prinsip-prinsip fleksibilitas sehingga pebelajar memperoleh kemudahan mendapatkan informasi dalam rangka memecahkan masalah, dan strategi penilaian mengacu pada pencapaian kebutuhan kompetensi yang diharapkan. Berdasarkan uji keefektifan model, terdapat saran sebagai berikut: (1) Model pembelajaran NCFL sebagai suatu hasil inovasi perlu segera diimplementasikan kedalam praktek pembelajaran di Akademi Angkatan Laut. Kurikulum dan program pembelajaran Psikologi Massa segera disempurnakan mengacu pada hasil pengembangan. (2) Model pembelajaran NCFL segera didiseminasikan melalui tahapan instalasi dengan prosedur dan langkah-langkah yang telah ditetapkan, meliputi rangkaian proses difusi inovasi, institusionalisasi, penjaminan kualitas serta pengkajian dan pengembangan. (3) Dalam rangka pengembangan lebih lanjut, terdapat beberapa hal yang perlu ditindaklanjuti: model pembelajaran NCFL dapat dikembangkan pada bidang studi lain yang sejenis atau serumpun, program pengembangan perlu tim partisipasi pengembangan yang kuat dan solid, serta masih membutuhkan pengkajian dan pengembangan lebih lanjut untuk mendapatkan proses dan hasil pembelajaran yang lebih baik.

Studi tentang ragam hias bordir dan proses pembuatan kerajinan bordir di rumah busana "Faiza Bordir" di Desa Kalirejo, Kecamatan Bangil, Kabupaten Pasuruan / Sonie Maulana

 

Kata Kunci: Identifikasi ragam hias, motif, seni kerajinan, bordir Seni kerajinan Bordir sudah membudaya di Indonesia. Seni Bordir selalu hidup dan berkembang, disukai masyarakat dan dapat diaplikasikan dalam berbagai karya. Keindahan sebuah karya bordir mempunyai daya tarik dan nilai tambah tersendiri. Hampir semua seni kerajinan perlu didukung oleh motif ragam hias seperti batik, keramik, porselen dll. Begitu pula seni kerajinan bordir, ragam hias memegang peran utama. Karena ragam hias sangat menentukan dalam membuat karya bordir yang indah, variatif dan penuh warna. Bordir merupakan salah satu warisan seni/budaya Indonesia yang mempunyai nilai seni tinggi. Guna melestarikan warisan budaya tersebut "Faiza Bordir" terus berupaya mengembangkan seni bordir dengan produk-produk yang digali dari khazanah budaya dan seni Indonesia. Tujuan dari penelitian ini adalah (1) mengidentifikasi macam ragam hias kerajinan bordir yang terdapat pada rumah busana "Faiza Bordir" (2) proses pembuatan kerajinan bordir pada rumah busana "Faiza Bordir". Untuk mencapai tujuan tersebut, pendekatan yang digunakan dalam penelitian ini adalah pendekatan kualitatif, karena pada penelitian ini berusaha mengungkapkan gejala secara menyeluruh dan sesuai dengan konteks melalui pengumpulan data dari latar alami dengan memanfaatkan diri peneliti sebagai instrumen kunci. Alternatif metode yang diambil ini adalah metode deskriptif. Hal-hal yang berkaitan dengan ragam hias desain kerajinan bordir pada rumah busana "Faiza Bordir" di dusun Kalirejo, Kecamatan Bangil, Kabupaten Pasuruan akan dideskripsikan dalam penelitin ini. Hasil dari penelitian ini adalah (1) jenis produk yang dihasilkan dibedakan menjadi dua, yaitu produk busana dan produk non-busana. Pada produk busana antara lain, blus, kebaya, mukena, baju gamis, gaun, kemeja, baju anak, kerudung dan busana muslim. Sedangkan pada produk non-busana antara lain, taplak meja, tempat tisu, sampul buku/sampul Al-Qur'an, tas jinjing/tas wanita, penutup dan tatakan gelas, sarung bantal, kipas, sepatu dan kotak seserahan. (2) ragam hias untuk menghias produknya, yaitu motif geometris dan motif non-geometris. (3) Alat untuk membuat kerajinan bordir yaitu mesin bordir, pemidangan, kertas minyak/kertas roti, kertas karbon, gunting, solder dan setrika. Bahan untuk membuat kerajinan bordir yaitu kain dan benang. (4) terdapat tiga proses utama pembuatan kerajinan bordir pada Rumah Busana "Faiza Bordir" yang meliputi tahap persiapan, tahap inti dan tahap akhir.

Penerapan kolaborasi model pembelajaran inquiry dan model pembelajaran student team achievement division (STAD) untuk meningkatkan hasil belajar siswa pada mata pelajaran keamanan, kesehatan, keselamatan kerja dan lingkungan hidup / Christi Izhati Choirina Dewi

 

Kata Kunci: Model Pembelajaran Inquiry, Student Team Achievement Division, Hasil belajar siswa. Membangun interaksi edukatif sangat sulit, kenyataan menunjukkan bahwa kegiatan belajar mengajar dengan metode konvensional dengan ceramah yang diterapkan oleh guru kurang menarik perhatian siswa untuk berperan aktif di dalam kelas serta menimbulkan kejenuhan bagi siswa. Hal ini yang selanjutnya berdampak pada hasil belajar siswa kelas X APK SMK Cendika Bangsa yang menunjukan hasil belajar yang belum optimal yang dapat terlihat dari hasil nilai ujian tengah semester yang sebagian besar belum memenuhi standart minimal. Salah satu model pembelajaran kolaboratif yang dapat membantu meningkatkan kemampuan siswa dalam proses belajar adalah kolaborasi model pembelajaran Inquiry dan model pembelajaran Student Team Achievement Division (STAD). Pembelajaran yang lebih memungkinkan siswa untuk lebih aktif dan bertanggung jawab penuh untuk memahami materi pelajaran baik secara berkelompok maupun individual, sehingga diharapkan dapat meningkatkan hasil belajar siswa. Penelitian ini bertujuan untuk mengetahui beberapa hal, yang mencakup penerapan kolaborasi model pembelajaran inquiry dan model pembelajaran student team achievement division (STAD) pada mata pelajaran Keamanan, Kesehatan, Keselamtan Kerja dan Lingkungan Hidup (K3LH), hasil belajar siswa kelas X APK SMK Cendika Bangsa setelah adanya penerapan model pembelajaran kolaborasi ini, hambatan dan solusi yang dihadapi, serta respon siswa kelas X APK SMK Cendika Bangsa terhadap penerapan model pembelajaran kolaborasi inquiry dan STAD pada mata pelajaran K3LH. Penelitian ini menggunakan rancangan penelitian tindakan kelas dengan jenis data kualitatif serta pendekatan partisipatif sehingga peneliti terjun langsung dalam pengumpulan data. Data yang diperoleh berupa hasil belajar siswa kelas X APK SMK Cendika Bangsa, lembar observasi, catatan lapangan dan angket respon siswa. Kegiatan penelitian dimulai dengan perencanaan, pelaksanaan tindakan, pengamatan dan refleksi. Hasil penelitian ini menunjukkan bahwa; 1) Berdasarkan hasil observasi pada aktivitas belajar siswa yang dilakukan di setiap siklus, diketahui adanya peningkatan yang “sangat baik” terhadap penerapan kolaborasi model pembelajaran Inquiry dan model pembelajaran Student Team Achievement Division (STAD), 2) Setelah adanya penerapan kolaborasi model pembelajaran Inquiry dengan model pembelajaran Student Team Achievement Division (STAD), hasil belajar siswa lebih baik (meningkat) dibandingkan dengan sebelum adanya penerapan kolaborasi model pembelajaran Inquiry dan model pembelajaran Student Team Achievement Division (STAD), 3) Hambatan yang dihadapi peneliti dalam penelitian penerapan kolaborasi model pembelajaran Inquiry dan model pembelajaran Student Team Achievement Division (STAD) adalah Siswa mengalami kesulitan untuk menemukan fakta nyata yang terkait dengan materi yang dijarkan, Kolaborasi model Pembelajaran Inquiry dan Student Team Achievement Division belum pernah ada sebelumnya, alokasi waktu yang digunakan kurang efektif terutama pada pelaksanaan pembelajaran Siklus I yaitu pada pembentukan kelompok dan pengerjaan soal diskusi kelompok dan pembahasannya, siswa kurang memahami pelaksanaan diskusi yang baik, Siswa kurang berani untuk mengemukakan pendapat dalam diskusi kelas, dan 4) Respon siswa terhadap penerapan kolaborasi model pembelajaran Inquiry dan model pembelajaran Student Team Achievement Division (STAD) pada mata pelajaran Keamanan, Kesehatan, Keselamatan Kerja dan Lingkungan Hidup adalah sangat positif. Saran yang dapat diberikan setelah adanya penerapan kolaborasi model pembelajaran ini antara lain: Saran bagi kementerian pendidikan, penelitian ini dapat dijadikan bahan dalam mengembangkan atau memperbaiki kebijakan yang berkaitan dengan peningkatan mutu pendidikan melalui penerapan model pembelajaran dalam kegiatan belajar-mengajar, bagi pihak guru untuk inovatif dalam penggunaan model pembelajaran kolaboratif guna meningkatkan hasil belajar siswa, bagi siswa hendaknya selalu mengikuti kegiatan belajar mengajar dengan sungguh-sungguh melalui penerapan model pembelajaran lainnya yang dapat meningkatkan pemahaman siswa terhadap materi yang diajarkan.

Inovasi produk crackers dengan substitusi tepung garut / Dewi Rafika

 

Kata Kunci: garut, crackers. Garut merupakan salah satu jenis umbi yang berpotensi untuk menjadi alternatif sumber pangan. Garut juga merupakan umbi yang berpotensi menjadi substituen terigu dalam pembuatan kue kering, mie, dan roti tawar apabila dibuat tepung terlebih dahulu. Salah satu faktor penentu dalam proses pembuatan crackers adalah gluten, yang hanya terdapat pada tepung terigu karena crackers merupakan salah satu jenis kue kering yang memerlukan gluten dalam proses pembuatannya. Gluten yaitu protein yang tidak larut dalam air, mempunyai sifat elastis seperti karet dan merupakan kerangka dari crackers dimana gluten akan menahan gas yang dihasilkan dari pekerjaan yeast. Penelitian ini merupakan penelitian eksperimen pembuatan crackers yang disubstitusi tepung garut sebanyak 20%, 30%, dan 40%. Tujuan penelitian ini adalah untuk mengetahui volume pengembangan, dan sifat organoleptik yang meliputi warna, rasa, dan tekstur melalui uji pembedaan pasangan dan uji hedonik. Pengambilan data menggunakan panelis agak terlatih yaitu mahasiswa Tata Boga angkatan 2007-2008. Analisis menggunakan analisis sidik ragam dan Duncan’s Multiple Range Test (DMRT). Hasil penghitungan volume pengembangan crackers yang disubstitusi tepung garut sebanyak 20%, 30%, dan 40% menghasilkan volume yang paling tinggi yaitu substitusi garut sebanyak 20%. Hasil uji pembedaan pasangan crackers yang disubstitusi tepung garut sebanyak 40% menghasilkan warna, rasa, dan tekstur sesuai dengan kriteria yang diharapkan. Sedangkan untuk hasil uji hedonik crackers garut menunjukkan semakin tinggi jumlah tepung garut yang digunakan dalam batas maksimal pada pembuatan crackers garut, maka panelis semakin menyukai rasa, warna dan tekstur crackers garut. Crackers garut dengan substitusi tepung garut sebanyak 40% merupakan crackers garut yang menghasilkan rasa (gurih), warna (kuning gading) dan tekstur (renyah) yang cenderung disukai oleh panelis. Kesimpulan penelitian ini adalah substitusi tepung garut yang berbeda dalam pembuatan crackers akan menghasilkan volume pengembangan dan sifat organoleptik yang berbeda.. Saran bagi peneliti selanjutnya ialah melakukan penelitian tentang pemanfaatan tepung garut untuk produk yang lain.

Implementasi inovasi pembelajaran di Madrasah Aliyah Negeri Mojosari / Ian Angga Atiawati

 

Kata Kunci : Inovasi, Pembelajaran. Madrasah Aliyah Negeri Mojosari lembaga pendidikan keagamaan. Adanya anggapan masyarakat awam bahwa pendidikan madrasah adalah lembaga pendidikan atau sekelas dua yang hanya mengajarkan ilmu-ilmu agama dan kurang memperhatikan ilmu-ilmu pengetahuan umum, sehingga menyebabkan perkembangan yang terjadi sangat lambat terutama dalam upaya peningkatan kualitas pembelajaran akibat rendahnya animo masyarakat terhadap lembaga madrasah itu sendiri. Sebagai sekolah berciri keagamaan Islam yang setingkat Sekolah setingkat dengan Sekolah Lanjutan Tingkat Atas, Madrasah Aliyah Negeri (MAN) Mojosari memiliki tanggung jawab untuk mengemban terwujudnya insan yang memiliki IPTEK dan IMTAQ yang seimbang sehingga dari periode awal didirikanya hingga pada saat sekarang ini terjadi banyak kemajuan di bidang pendidikan dan secara berangsur-angsur anggapan masyarakat mengenai madrasah sebagai lembaga pendidikan kelas dua mulai berubah. Penelitian ini bertujuan untuk: (1) mendeskripsikan ide inovasi pembelajaran MAN Mojosari, (2) mendeskripsikan keinovatifan fasilitas pembelajarn di MAN Mojosari, (3) mendeskripsikan metode pembelajaran di MAN Mojosari, (4) mengetahui faktor-faktor apa yang berpengaruh terhadap pelaksanaan inovasi (pendukung maupun penghambatnya). Penelitian ini dilakukan di MAN Mojosari , tanggal 27 September sampai 8 November 2010. Metode penelitian yang digunakan adalah penelitian deskriptif kualitatif. Metode pengumpulan data menggunakan metode observasi, wawancara dan dokumentasi, analisis hasil penelitian yang dipakai adalah menguraikan, menafsirkan dan menggambarkan data. Hasil penelitian ini menunjukkan bahwa : (1) dalam melaksanakan inovasi pendidikan, MAN Mojosari memiliki otonomi dalam melakukan modifikasi kurikulum, pengadaan sumber dana dan peningkatan kuantitas maupun kualitas guru, (2) inovasi yang dilakukan pada fasilitas pembelajaran berupa pembenahan fasilitas gedung yang representatif, pembangunan laboratorium komputer, laboratorium bahasa, laboratorium IPA dan perpustakaan yang dilengkapi dengan audio visual aids, yang dengan semua fasilitas tersebut memungkinkan kegiatan belajar mengajar berlangsung dengan adanya keterlibatan yang lebih interaktif pada siswa, (3) bentuk inovasi di bidang metode pembelajaran yang dilakukan berupa siswa memilih sendiri program untuk kelas XI dan XII sesuai dengan kemampuanya,dan guru memilih metode dan media pembelajaran yang sesuai untuk digunakan pada masing-masing kelas, (4) guru menggunakan metode lama yaitu metode ceramah yang membosankan, fasilitas fasilitas yang kurang lengkap dan sudah banyak yang sudah adalah menjadi faktor yang berpengaruh terhadap pelaksanaan inovasi. Sebagai bahan pertimbangan bagi guru di Lembaga Pendidikan Agama MAN Mojosari dalam meningkatkan mutu pendidikan yang lebih baik ada beberapa saran sebagai masukan, antara lain: (1) adanya inovasi pendidikan dengan pendekatan high technology yang diterapkan maka MAN Mojosari dapat mencoba pendekatan lain yang menggunakan konsep kembali ke alam sebagai upaya lebih mendekatkan siswa dalam pembelajaran yang tidak banyak bergantung dengan pemanfaatan kemajuan teknologi, (2) fasilitas pembelajaran yang dimilki MAN Mojosari sebagai hasil dari pelaksanaan inovasi pendidikan diharapkan mampu memberikan kontribusi yang dapat merperan dalam peningkatan kualitas pembelajaran di lembaga pendidikan lain yang setingkat, yaitu dengan memberi kesempatan untuk melakukan kerjasama dan kesempatan untuk ikut menggunakannya sehingga diharapkan dapat menambah wawasan dan dapat meningkatakna kualitas pembelajrannya, (3) untuk pemerintah, dalam hal ini Departemen Agama dan Departemen Pendidikan Nasional, hendaknya memberikan kemudahan baggi lembaga-lembaga pendidikan lain dalam hal otonomi pendidiakan sehingga selain dapat meningkatkan kemandirian lembaga juga dapat meningkatkan motivasi untuk berprestasi, (4) membenahi peralatan dan menambah koleksi inventaris di laboratorium serta manginovasi metode mengajar guru adalah hal yang penting, agar proses inovasi berjalan dengan lancar.

Pengaruh metode ACM dan metode inova kreatif 32 hari terhadap kemampuan membaca dan menulis pada program percepatan penuntasan buta aksara tingkat dasar: studi eksperimen di Desa Mas-mas Kecamatan Batukliang Utara Kabupaten Lombok Tengah Provinsi Nusa Tenggara Barat / N

 

Program Studi Pendidikan Luar Sekolah. Program Pasca Sarjana. Universitas Negeri Malang.Pembimbing I Prof. Drs. M.Saleh Marzuki, M.Ed, Pembimbing II Dr. Supriyono, M.Pd. Kata Kunci: metode pembelajaran, kemampuan membaca, kemampuan menulis, penuntasan buta aksara. Hasil survei pendahuluan penelitian ini menunjukkan bahwa permasalahan yang dihadapi pemerintah provinsi NTB khususnya pada bidang pendidikan, dan berdampak pada rendahnya IPM adalah masih tingginya angka buta aksara. Data Badan Pusat Statistik tahun 2009 (www.bps.go.id) terungkap bahwa Provinsi NTB merupakan 1 dari 10 Provinsi kantong buta aksara terbesar di Indonesia. Tingginya angka penyandang buta aksara menjadi faktor utama terpuruknya IPM NTB di level bawah. Data terakhir, provinsi NTB berada di ranking 32 dari 33 provinsi di Indonesia, untuk jumlah penduduk yang buta aksara atau setingkat diatas Papua Barat (Suara NTB, 9 Januari 2010). Atas dasar ini diduga bahwa rendahnya nilai kemampuan hasil belajar WB yang berdampak pada tingginya angka buta aksara tersebut, erat kaitannya dengan metode pembelajaran yang digunakan. Oleh karena itu perlu dicarikan metode pembelajarn lain yang mungkin akan lebih efektif. Dalam penelitian ini dicobakan Metode Inova Kreatif 32 Hari dan Metode ACM. Tujuan dari penelitian ini adalah ingin mengetahui apakah ada perbedaan kemampuan membaca dan menulis antara WB yang dibelajarkan dengan menggunakan Metode ACM dan WB yang dibelajarkan dengan menggunakan Metode Inova Kreatif 32 Hari. Rancangan penelitian ini menggunakan eksperimen kuasi non equivalent control group design. Dipilih 8 kelompok belajar yang dinilai ”sama” kondisi awal variabel-variabelnya. Dengan teknik Purposive Random Sampel dipilih 8 kelompok belajar (1 kelompok 10 orang WB) buta aksara di Desa Mas-mas Kecamatan Batukliang Utara Kabupaten Loteng. Melalui undian 4 kelompok belajar sebagai kelompok eksperimen dan 4 kelompok belajar sebagai kelompok kontrol. Penelitian dilakukan selama enam bulan, dari bulan Mei sampai Oktober 2010. Adapun pengambilan data dilakukan melalui tes (pretes dan postes, angket, dokumentasi dan wawancara. Selanjutnya data dianalisis dengan uji beda rerata melalui uji t. Hasil penelitian ini menunjukkan bahwa 1) Terdapat perbedaan kemampuan belajar membaca antara WB yang dibelajarkan dengan metode ACM dan WB yang dibelajarkan dengan metode Inova Kreatif 32 Hari pada program percepatan penuntasan buta aksara tingkat dasar di Desa Mas-mas Kecamatan Batukliang Utara Kabupaten Loteng. Kemampuan belajar membaca WB yang dibelajarkan dengan metode ACM lebih tinggi dibandingkan dengan kemampuan belajar membaca yang dibelajarkan dengan metode Inova Kreatif 32 Hari, 2) Terdapat perbedaan kemampuan belajar menulis antara WB yang dibelajarkan dengan metode ACM dan WB yang dibelajarkan dengan metode Inova Kreatif 32 Hari pada program percepatan penuntasan buta aksara tingkat dasar di Desa Mas-mas Kecamatan Batukliang Utara Kabupaten Loteng. Kemampuan belajar menulis WB yang dibelajarkan dengan metode ACM lebih tinggi dibandingkan dengan kemampuan belajar membaca yang dibelajarkan dengan metode Inova Kreatif 32 Hari. Berdasarkan temuan-temuan penelitian tersebut diatas, direkomendasikan: 1) Metode ACM dapat menjadi bahan referensi dan menjadi alternatif dalam merencanakan dan melaksanakan pembelajaran buta aksara dalam rangka meningkatkan kualitas hasil kemampuan membaca dan menulis WB, sehingga dapat membantu mempercepat penurunan jumlah WB yang buta aksara. Metode ACM yang digunakan ini terbukti efektif untuk program penuntasan buta aksara, maka perlu diupayakan penyebarluasan penerapan metode ACM pada penyelenggaraan program penuntasan buta aksara tingkat dasar, 2) Kepada pihak penyelenggara program pendidikan keaksaraan, hendaknya tutor dibekali dengan wawasan dan kemampuan tentang metode ACM. Kepada tutor buta aksara sebaiknya mempelajari dan menerapkan metode ACM ini mulai dari teknik dan langkah-langkah praktisnya sesuai dengan metodologi ACM secara konsisten dan sesuai dengan standar yang telah ditentukan. Pembekalan kemampuan tutor dikemas dalam satu program pelatihan tutor yang dirancang selama 3 hari (@ 8 jam efektif). Dengan alokasi waktu 2 hari untuk mempelajari metodologi ACM dan 1 hari untuk micro teaching (latihan mengajar), dengan maksimal peserta pelatihan 30 orang, 3) Kepada pihak pemerintah desa dan pemerintah daerah agar dalam menyelenggarakan program pendidikan keaksaraan tingkat dasar dapat melibatkan maupun bekerjasama dengan lembaga-lembaga PLS, dan memberikan kesempatan kepada mahasiswa jurusan PLS yang lainnya untuk menindaklanjuti dan mengembangkan penelitian. Untuk memperoleh gambaran yang lebih akurat tentang kemanfaatan dan keefektifan penerapan Metode ACM pada pembelajaran buta aksara tingkat dasar disarankan untuk melakukan penelitian lanjutan pada; (a) kelompok pembanding dengan menggunakan metode pembelajaran buta aksara yang lain, (b) pokok bahasan yang berbeda dengan pokok bahasan pada penelitian ini, dan (c) subyek dengan lokasi penelitian (desa) berbeda secara geografis, misalnya antara desa pinggiran hutan dengan desa pinggiran sungai/laut, 4) Kepada praktisi dan pengembang kajian PLS supaya bisa lebih banyak dan lebih intensif memberikan kontribusi dalam pengembangan model-model pendidikan keaksaraan yang lebih inovatif bagi WB buta aksara tingkat dasar, dan 5) Kepada jurusan PLS sebagai lembaga pendidikan agar lebih intensif dalam memberikan layanan pendidikan bagi warga buta aksara. Setelah Program keaksaraan tingkat dasar ini dinyatakan tuntas, maka dapat dilanjutkan dengan program-program pemberdayaan atau kegiatan pelestarian untuk WB. Yaitu serangkaian kegiatan ekonomi dan non ekonomi yang berorientasi pada pemeliharan dan sekaligus peningkatan kemampuan keaksaraan sehingga WB tidak menjadi buta aksara kembali dan bertujuan untuk meningkatkan taraf ekonomi dan kesejahteraan hidup WB buta aksara.

Pembelajaran berbasis model hybrid pembelajaran online dan kelas pada mata pelajaran TIK Disma Pawyatan Daha Kediri / Yudi Prio Hastowo

 

Kata kunci: Hybrid, Mata pelajaran Teknologi informasi dan komunikasi Siswa-Siswi yang ada disma pawyatan daha Kediri perlu adanya pemahaman tentang pemanfaatan teknologi sebagai sebuah media pembelajaran untuk menghadapi era Globalisasi, Berdasarkan hasil observasi di sma pawyatan daha Kediri , guru mengalami kesulitan untuk menyampaikan materi tentang mata pelajaran TIK. Selama ini siswa hanya diberi buku dan di jelaskan , Dan guru Menjelaskan diddalam kelas ,siswa malu bertaya secara lansung didalam kelas. Model Pengembangan Desain Pembelajaran Blended Berbasis Web Geyle dan Rasmussen dipilih berdasarkan kesesuaian terhadap kebutuhan karateristik pengembangan. Metode Pengembangan Desain Pembelajaran Berbasis Web Model Geyle dan Rasmussen memiliki fase-fase pengembangan anatara lain : 1). Analisa; 2). Rencana Evaluasi 3) Fase Bertautan yang meliputi desain, pengembangan sistim, ujicoba dan Implementasi dan evaluasi Formatif. Fase ini dapat dilakukan bekali-kali hingga batas waktu yang tidak ditentukan; 4). Implementasi Penuh; 5). Evaluasi Sumatif dan Penelitian. Kegiatan pengembangan pembelajaran melalui penerapan atau implementasi model Hybrid dengan melalui web dapat memberikan keuntungan-keutungan. (1) variasi media, secara umum siswa menggunakan media pembelajaran yang beragam. (2) Informasi baru, selain menyediakan informasi melalui lingkup sekolah , adalah bahan ajar dapat diperkaya melalui kegiatan akses internet yang terintegrasi (3) Pengembangan navigasi teknologi level user. Pada setiap Bab akan memperoleh hak akses yang berbeda (4) sistim dapat memfasilitasi komunikasi dan interaksi antara siswa dengan guru /nara sumber, meningkatkan kolaborasi antar siswa untuk membentuk komunitas belajar.

Pengaruh penggunaan metode pemodelan terhadap peningkatan pemahaman konsep fisika ditinjau dari pengetahuan awal siswa kelas X SMA Negeri Jember tahun pelajaran 2009-2010 / Muhammad Lutfi Helmi

 

Program Studi Pendidikan Fisika, Program Pascasarjana Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Malang. Pembimbing: (I) Dr. Markus Diantoro, M.Si. dan (II) Drs. Agus Suyudi, M.Pd. Kata kunci: pengetahuan awal, peningkatan pemahaman konsep, metode pemodelan, normalized gain. Pembelajaran fisika di sekolah pada umumnya masih didominasi oleh pola-pola pembelajaran yang tradisional; sementara itu penelitian menunjukkan bahwa pembelajaran tradisional pada umumnya gagal untuk mengatasi kesulitan konseptual dan membentuk pemahaman konseptual yang kohern. Metode pemodelan, yang merupakan salah satu metode pembelajaran yang menekankan pada kegiatan berpikir dan bertindak, telah dilaporkan berhasil meningkatkan pemahaman konseptual siswa di Amerika. Penelitian ini dimaksudkan untuk mengulang sukses yang sama dalam penerapan metode pemodelan pada tingkat sekolah menengah di Indonesia. Tujuan penelitian ini adalah untuk menguji (1) peningkatan pemahaman konsep siswa yang belajar dengan metode pemodelan dibandingkan dengan pembelajaran tradisional; (2) peningkatan pemahaman konsep siswa yang memiliki pengetahuan awal tinggi dibandingkan dengan yang memiliki pengetahuan awal rendah; (3) interaksi perbedaan metode pembelajaran dengan pengetahuan awal terhadap peningkatan pemahaman konsep siswa. Penelitian ini termasuk dalam kategori kuasi-eksperimen. Rancangan penelitian yang digunakan adalah desain faktorial 2 x 2. Sebanyak 27 siswa di kelas X.1 SMA Negeri 1 Jember tahun pelajaran 2009-2010 belajar dengan metode pemodelan pada materi listrik DC. Sebagai kontrol, kelas X.4 sebanyak 29 siswa, belajar dengan pembelajaran tradisional. Pengetahuan awal siswa dilihat dari nilai pretes; sedangkan peningkatan pemahaman siswa diukur dengan normalized gain dari nilai pretes dan postes siswa. Analisis data menggunakan Anava dua faktor, dilanjutkan dengan uji t. Hasil penelitian ini menunjukkan bahwa siswa yang belajar dengan metode pemodelan mengalami peningkatan pemahaman konsep lebih baik daripada yang belajar dengan pembelajaran tradisional. Penelitian ini juga menemukan bahwa tidak ada perbedaan signifikan peningkatan pemahaman konsep siswa dengan pengetahuan awal tinggi dibandingkan dengan siswa yang memiliki pengetahuan awal rendah. Temuan penelitian ini juga menunjukkan bahwa tidak ada interaksi antara penggunaan metode pembelajaran berbeda dengan tingkat pengetahuan awal siswa. Temuan penelitian ini sejalan dengan beberapa penelitian sebelumnya, namun masih menyisakan beberapa persoalan. Pertama, nilai postes kedua kelas masih rendah. Hal ini dimungkinkan karena karakter tingkat kesulitan instrumen dan materi bagi level berpikir siswa. Kedua, normalized gain metode pemodelan dalam penelitian ini masih berada pada kategori rendah, menurut kriteria Hake; sementara penelitian metode pemodelan lain menunjukkan normalized gain pada level sedang, bahkan mendekati tinggi. Dimungkinkan, resistensi siswa, kesulitan dalam mengintegrasikan komponen-komponen metode pemodelan, belum tercapainya level operasional formal, serta perbedaan tingkat kesulitan instrumen pengukuran sebagai faktor-faktor yang berpengaruh terhadap rendahnya hasil tersebut.

Analisis kesalahan konsep matematika pada buku teks SMA kelas X / Parman Thaib Renngiwur

 

Kata Kunci : kesalahan konsep, konsep, buku teks. Matematika memiliki objek kajian yang bersifat abstrak, maka kualitas buku teks matematika akan mempengaruhi keberhasilan pembelajaran. hal tersebut dapat terjadi karena untuk mempelajari suatu materi matematika yang baru, pengalaman belajar yang lalu dari seseorang itu akan mempengaruhi terjadinya proses belajar materi matematika tersebut. Adanya kesalahan konsep matematika dalam buku teks, akan mengakibatkan siswa mempunyai pemahaman konsep yang salah dan akan mengalami kesulitan dalam mengembangkan maupun memahami konsep yang selanjutnya Kegiatan utama penelitian ini adalah menganalisis isi buku teks matematika SMA & MA kelas X yaitu dalam hal kesalahan dan dengan tujuan untuk perbaikan konsep tersebut. buku teks yang di gunakan sebagai bahan analisis adalah : PPM, dan berdasarkan hasil analisis, di temukan kesalahan konsep pada buku tersebut sebanyak 16 keslahan. Dari hasil analisis, ditemukan kesalahan konsep pada buku teks matematika SMA kelas X. Saran-saran yang dapat diberikan sebagai berikut. (1) Guru hendaknya tidak mengikuti sepenuhnya konsep yang disajikan dalam buku teks dan tidak hanya menggunakan satu buku sebagai bahan rujukan dalam membimbing siswa. (2) Siswa hendaknya tidak menggunakan satu buku sebagai acuan dalam belajar dan memilih buku yang berkualitas agar memperoleh konsep materi yang benar. (3) Sekolah hendaknya lebih teliti dalam memilih buku teks matematika yang akan digunakan. (4) Penulis buku teks hendaknya meneliti kembali konsep-konsep yang disajikan pada buku teks dan memperbaiki kesalahan konsep yang ada agar pembaca lebih memahami apa yang mereka pelajari. (5) Penerbit hendaknya merevisi kesalahan konsep yang ada pada buku teks dan agar lebih teliti sebelum menerbitkan buku. (6) Penelitian hendaknya ditingkatkan pada ruang lingkup yang lebih luas. Analisis tidak hanya ditinjau dari aspek konsep materi tetapi diharapkan analisis dikembangkan pada aspek yang lain.

Strategi kepala sekolah dalam pemberdayaan guru di SMP Negeri 1 Genteng dan SMP Bustanul Makmur Genteng Kabupaten Banyuwangi / Supriyadi

 

Program Studi Manajemen Pendidikan, Program Pascasarjana, Universitas Negeri Malang. Pembimbing: (I) Prof. A. Sonhadji KH, M.A., Ph.D dan (II) Prof. Dr. Willem Mantja, M.Pd Kata kunci: pemberdayaan guru, kemampuan, pembuatan keputusan, motivasi, budaya sekolah Pemberdayaan guru merupakan salah satu bentuk reformasi di bidang pen-didikan yang amanat pelaksanaannya ditegaskan dalam Undang-undang nomor 14 tahun 2005 tentang Guru dan Dosen. Kepala sekolah sebagai pemimpin satuan pendidikan dan atasan langsung dari guru memiliki kewajiban untuk mewujudkan strategi pemberdayaan guru secara efektif. Berkaitan dengan hal ini, secara praktis pertanyaan yang mengemuka adalah bagaimana wujud strategi kepala sekolah da-lam pemberdayaan guru yang efektif dan sesuai dengan semangat kehadiran Un-dang-undang di atas. Dalam konteks inilah perlunya dilakukan penelitian yang bertemakan pemberdayaan guru. Penelitian ini bertujuan memerikan strategi kepala sekolah dalam pember-dayaan guru. Sesuai dengan fokus penelitian, empat dimensi pemberdayaan guru yang diperikan terdiri atas dimensi membuat mampu (enabling), pelibatan guru dalam pembuatan keputusan, pemberian motivasi, dan pengembangan budaya se-kolah. Keempat dimensi ini dipandang merepresentasikan kegiatan pemberdayaan guru di organisasi sekolah. Pendekatan yang digunakan dalam penelitian ini adalah pendekatan kuali-tatif dengan rancangan multisitus. Data penelitian yang berupa cara atau kiat yang ditempuh oleh kepala sekolah dalam memberdayakan guru diperoleh dari informan dan dokumen. Informan yang dimaksudkan adalah kepala sekolah dan guru SMP Negeri 1 Genteng dan SMP Unggulan Bustanul Makmur Genteng kabupaten Banyuwangi. Studi multisitus ini menempatkan dua kepala sekolah yang bersang-kutan sebagai informan kunci. Pengumpulan data dilakukan dengan wawancara, studi dokumentasi, dan observasi. Data yang terkumpul dianalisis secara cermat dan berulang dengan tiga tahapan utama, yaitu reduksi data, sajian data, dan veri-fikasi atau penarikan kesimpulan yang dilakukan di dalam situs maupun lintas situs guna merekonstruksikan temuan penelitian. Kredibilitas data dicek dengan tri-angulasi sumber data, triangulasi metode, dan kecukupan referensi. Adapun de-pendabilitas dan konfirmabilitas dilakukan dengan bantuan audit oleh dosen pem-bimbing. Temuan penelitian menunjukkan bahwa dalam melakukan kegiatan pem-berdayaan guru, kepala sekolah menempuh berbagai cara. Cara atau kiat ini mau-jud dalam empat dimensi kegiatan pemberdayaan guru. Cara atau kiat pember-dayaan guru untuk dimensi membuat mampu meliputi kegiatan kolaborasi sejawat dan pengembangan profesional individu. Kolaborasi sejawat dilakukan dalam bi-dang: (1) pengembangan kurikulum, (2) pembuatan perencanaan pembelajaran, (3) proses pembelajaran, (4) memeriksa dan mendiskusikan karya siswa, (5) kolaborasi sejawat dengan sekolah cluster, (6) pementoran kepada guru baru dan (7) berpartisipasi dalam kelompok studi, (8) penyusunan soal, (9) penguasaan bahasa Inggris, (10) kolaborasi antar-Tim Pengembang dalam acara khusus, (11) penggu-naan Teknologi Informasi (TI), (12) kolaborasi dengan sukarelawan dari pemerin-tah Australia, dan (13) kunjungan edukatif. Adapun pengembangan profesional individu dilakukan dengan: (1) meningkatkan kualifikasi pendidikan ke jenjang S2, (2) menghadiri seminar, (3) mendatangkan ahli untuk Bimbingan Teknis, (4) mendatangkan pemegang otoritas di bidang pendidikan, (5) mengikutkan guru dalam Pendidikan dan Pelatihan di luar sekolah, (6) mengadakan pelatihan di in-ternal sekolah, (7) mengikutkan guru dalam kegiatan workshop, (8) membantu guru dalam menemukan solusi masalah yang dialami, (9) mendatangkan ahli untuk satu cluster RSBI, (10) mendelegasikan tugas, (11) memberikan otoritas, (12) memperdalam penguasaan Teknologi Informasi, (13) peningkatan penguasaan bahasa Inggris, (14) penyampaian umpan balik secara terbuka, (15) memberikan umpan balik secara pribadi, (16) mengidentifikasi berbagai peluang, (17) kebeba-san berinovasi, (18) melengkapi fasilitas sekolah, dan (19) membantu guru dalam menemukan solusi masalah yang dialami. Pelibatan guru dalam pengambilan ke-putusan dilakukan untuk isu: 1) penentuan struktur administratif dan organisasi sekolah, (2) dalam penentuan personil setiap divisi, (3) penyusunan Rencana Kegiatan dan Anggaran Sekolah (RKAS), (4) pengembangan layanan untuk guru di sekolah, (5) penilaian kinerja dan supervisi guru, (6) evaluasi setiap divisi, dan (7) penyusunan dokumen KTSP, (8) penentuan kedisiplinan siswa, (9) penen-tuan Kriteria Ketuntasan Minimal, (10) pemilihan buku teks, (11) penentuan skala prioritas program, (12) memperkuat jalinan hubungan sekolah dengan orang tua, (13) kegiatan studi edukatif, (14) tata cara penilaian siswa, dan (15) pembagian tugas mengajar. Sementara pemberian motivasi kepada guru dilakukan dengan: (1) pemanfaatan acara seremonial, (2) penggunaan kata mutiara, (3) pemberian dana kesejahteraan atau insentif, (4) penyampaian nilai-nilai moral, (5) pemerataan dalam pendistribusian tugas tambahan, (6) pemberian tindak lanjut pada guru yang berprestasi, (7) pemberian hadiah secara bersyarat, (8) peningkatan status guru, (9) bantuan finansial untuk keperluan pendidikan guru, (10) pengusahaan fasilitas hidup, (11) pemberian spirit yang positif, dan (12) mengapresiasi prestasi guru di depan pengguna (orang tua siswa). Adapun wujud nilai dan norma budaya sekolah yang dikembangkan adalah: (1) tujuan bersama, (2) kesejawatan dan kolaborasi, (3) berani mengambil risiko, (4) keterbukaan, (5) kepercayaan (trust), (6) saling mendukung, (7) demokratis, (8) saling menghormati, (9) keakraban dan ke-keluargaan, dan (10) kompetitif. Temuan tersebut menunjukkan bahwa keempat dimensi kegiatan pember-dayaan guru bersifat saling melengkapi. Oleh karena itu, disarankan agar kepala sekolah menjadikan kegiatan tersebut sebagai model untuk meningkatkan profe-sionalitas guru. Bagi guru, kegiatan pemberdayaan guru memberi peluang untuk mengaktualisasikan potensinya karena adanya keterlibatan yang intensif dalam proses pengambilan keputusan. Dinas Pendidikan Pemuda dan Olahraga juga di-harapkan mengisiasi dan memfasilitasi kegiatan pemberdayaan guru karena kapa-sitas yang dimilikinya amat diperlukan. Bagi peneliti disarankan untuk melakukan kajian lebih jauh atas dimensi-dimensi kegiatan pemberdayaan guru seperti di-mensi restrukturisasi organisasi dan self efficacy agar para pemimpin pendidikan memiliki lebih banyak lagi acuan untuk mengaktualisasikan kegiatan pember-dayaan guru.

Efektivitas strategi inkuiri terbimbing terhadap pemahaman konsep fisika ditinjau dari kerja ilmiah siswa SMA Negeri 1 pandaan tahun pelajaran 2009/2010 / Khusnur Rozi

 

Jurusan Pendidikan Fisika, Program Pasca Sarjana Universitas Negeri Malang. Pembimbing (I) Dr. H. Wartono, M.Pd., (II) Dr. Muhardjito, M.S. Kata Kunci: inkuiri terbimbing, pemahaman konsep, kerja ilmiah. Percobaan fisika yang digunakan di SMA Negeri Pandaan selama ini masih menggunakan strategi inkuiri terstruktur yang sangat dekat dengan cookbook laboratory, yang berpusat kepada guru. Siswa melaksanakan percobaan menggunakan petunjuk yang sangat jelas tanpa ada tantangan kognitif, sehingga siswa bekerja seperti robot, dan guru menemukan siswa tidak memperoleh pemahaman fisika yang cukup. Siswa memperoleh pemahaman yang baik bila mempunyai kemampuan memprediksi, membuat generalisasi dari benda yang diamati melalui percobaan, dan mengkomunikasikannya. Dalam pembelajaran, kemampuan tersebut merupakan bagian dari kerja ilmiah. Guru perlu merancang pembelajaran yang memberi kesempatan kepada siswa agar dapat mengembangkan kemampuan tersebut melalui percobaan fisika. Strategi inkuiri terbimbing menyediakan kesempatan belajar kepada siswa untuk mengembangkan kerja ilmiah tersebut. Penelitian ini bertujuan untuk(1) mengukur perbedaan pemahaman konsep siswa yang belajar dengan strategi inkuiri terbimbing dan yang belajar dengan strategi inkuiri terstruktur, (2) mengetahui interaksi antara strategi inkuiri dan kemampuan kerja ilmiah terhadap kemampuan pemahaman konsep siswa, dan (3) mengukur perbedaan pemahaman konsep siswa yang mempunyai kemampuan kerja ilmiah tinggi dan yang belajar dengan strategi inkuiri terbimbing dan pemahaman konsep siswa yang mempunyai kemampuan kerja ilmiah tinggi dan yang belajar dengan strategi inkuiri terstruktur. Rancangan penelitian yang digunakan adalah faktorial 2x2 dengan sampel cluster random sederhana. Populasi penelitian ini adalah siswa kelas X SMAN 1 Pandaan semester genap tahun pelajaran 2009/2010. Hasil penelitian ini menunjukkan bahwa: (1) pemahaman konsep siswa yang belajar dengan strategi inkuiri terbimbing lebih tinggi daripada yang belajar dengan strategi inkuiri terstruktur, (2) terdapat interaksi antara strategi inkuiri dan kemampuan kerja ilmiah terhadap kemampuan pemahaman konsep siswa, (3) pemahaman konsep siswa yang mempunyai kemampuan kerja ilmiah tinggi dan yang belajar dengan strategi inkuiri terbimbing lebih tinggi daripada pemahaman konsep siswa yang mempunyai kemampuan kerja ilmiah tinggi dan yang belajar dengan strategi inkuiri terstruktur. Berdasarkan hasil penelitian ini, disarankan agar guru sering menggunakan strategi inkuri terbimbing untuk memperkaya repertoar guru. Kepada peneliti lain disarankan untuk merancang penilaian aspek kognitif dan psikomotor yang lebih efektif dan efisien.

Peran guru dalam manajemen peningkatan mutu pendidikan sekolah dasar (studi multisitus pada SDN Sumberbrantas III, SDN Kepampang VII dan SDN Panggangreco IV) / Suwandi

 

Program Studi Manajemen Pendidikan, Program Pasca Sarjana Universitas Negeri Malang. Pembimbing: (1) Prof. Dr. Willem Mantja, M.Pd., (2) Prof. Dr. Salladien, (3) Prof. Ahmad Sonhadji K. H., M. A., Ph.D. Kata kunci: peran guru, manajemen pendidikan, peningkatan mutu, sekolah dasar. Salah satu penyebab rendahnya mutu pendidikan adalah kurang maksimalnya peran guru terhadap penyelenggaraan peningkatan mutu pendidikan di sekolah. Keberadaan guru sebagai pelaksana program yang pertama dan utama di sekolah diharapkan dapat memainkan perannya secara maksimal, sehingga dapat meningkatkan mutu pendidikan di sekolah. Namun kenyataan keberadaan guru belum maksimal dan efektif dalam peningkatan mutu pendidikan, karena guru lebih cenderung dituntut menghabiskan target materi dan target nilai ujian nasional. Akhirnya guru kurang menyentuh proses manajemen peningkatan mutu pendidikan secara keseluruhan dan belum sesuai dengan peran dan fungsinya untuk membantu kepala sekolah dalam manajemen peningkatan mutu pendidikan. Penelitian ini dilakukan di SD Negeri Sumberbrantas III, SD Negeri Kepampang VII dan SD Negeri Panggangreco IV, bertujuan untuk mendeskripsikan segenap fenomena dan peristiwa yang terjadi berkaitan dengan peran guru dalam manajemen peningkatan mutu pendidikan sekolah dasar, yang meliputi: (1) peran guru dalam penyusunan program peningkatan mutu pendidikan, (2) peran guru dalam pengorganisasian sumberdaya di sekolah, (3) peran guru dalam pelaksanaan program penigkatan mutu pendidikan, (4) peran guru dalam evaluasi pelaksanaan program peningkatan mutu pendidikan, dan (5) strategi guru dalam pelaksanaan program peningkatan mutu pendidikan di sekolah. Pendekatan yang digunakan dalam penelitian ini adalah pendekatan kualitatif, dengan menggunakan rancangan penelitian studi multisitus. Data penelitian berupa: data deskriptif yang diperoleh melalui wawancara dengan 12 informan, data dokumentasi tentang program peningkatan mutu pendidikan atau program pengembangan sekolah, dan notulen rapat keluarga sekolah, dan data observasi. Hasil penelitian disimpulkan, pertama, peran guru dalam penyusunan program peningkatan mutu pendidikan, yaitu: (1) sebagai perencana program, dengan melakukan pengkajian dan evaluasi program dan RAPBS tahun yang lalu, (2) sebagai pemberi masukan dan pertimbangan, sesuai pengkajian dan evaluasi program tahun lalu, (3) sebagai pendukung, aktivitas ini diwujudkan dengan menyetujui program dan RAPBS yang telah disusun melalui rapat pleno dan penganggarannya, (4) sebagai mediator/fasilitator, aktivitas ini diwujudkan dengan mensosialisasi program dan RAPBS kepada wali murid dan penggalangan dana melalui paguyupan kelas. Kedua, peran guru dalam pengorganisasian sumberdaya peningkatan mutu pendidikan yaitu: (1) sebagai pemberi masukan dalam pembuatan profil sekolah dan pembagian tugas, aktivitas peran ini diwujudkan dengan memberikan data prestasi siswa dan sosial ekonomi orang tua, (2) sebagai pendukung, peran ini diwujudkan dengan aktivitas membantu dan memberi dukungan kepada kepala sekolah dalam menyiapkan fasilitas fisik sesuai dengan kebutuhan, dan mendukung teman guru mengembangkan potensi dengan menganggarkan dana diklat, seminar, workshop dan KKG. Ketiga, peran guru dalam pelaksanaan program peningkatan mutu pendidikan yaitu: (1) guru sebagai nara sumber, aktivitas peran ini diwujudkan dalam proses pembelajaran, bahwa guru SD harus mampu dan menguasai seluruh matapelajaran yang diajarkan kepada siswa kecuali pendidikan agama, (2) guru sebagai pelaksana, aktivitas peran ini diwujudkan dengan melaksanakan program yang pertama dan utama, meskipun tugas guru SD merangkap tugas-tugas yang lain masih mampu menambah jam pembelajaran, (3) guru sebagai pemilik (handarbeni) program, aktivitas peran ini dilakukan dengan melaksanakan program secara optimal, karena merasa memiliki dan bertanggungjawab pelaksanaan program dan keberhasilan program peningkatan mutu pendidikan. Keempat, peran guru dalam evaluasi program peningkatan mutu pendidikan yaitu: (1) sebagai evaluator, aktivitas peran ini diwujudkan dengan melakukan evaluasi pelaksanaan program peningkatan mutu pendidikan. Tujuannya untuk mengetahui tingkat keberhasilan dan ketidak berhasilan pelaksanaan program pembelajaran, ekstrakurikuler, keuangan, sarana prasarana dan pasilitas lain berdasarkan obyek, waktu dan model serta cara evaluasi. Kelima, strategi guru dalam pelaksanaan program peningkatan mutu pendidikan adalah: (1) kepala sekolah bersama guru dalam penerimaan murid baru dengan melalui seleksi. Strategi ini dilakukan dengan tujuan agar dapat menjaring dan memilih calon siswa baru yang lebih baik, (2) melalui disiplin merupakan modal dasar untuk mencapai keberhasilan. Strategi ini dapat membantu proses pelaksanaan program peningkatan mutu pendidikan secara efektif dan efesien, (3) mengadakan meeting, strategi ini dilakukan untuk mengantisipasi permasalahan dan pekerjaan yang dihadapi pada hari ini dan sedikit evaluasi kegiatan kemarin, (4) hubungan kekeluargaan di sekolah diseeting seperti keluarga di rumah. Strategi ini dilakukan agar tercipta hubungan yang harmonis. Tujuannya agar dapat dengan mudah diajak kerjasama saling membantu dan mudah diajak komitmen dalam proses peningkatan mutu pendidikan, (5) penyelenggaraan pendidikan yang transparansi dan akuntabilitas. Strategi ini dilakukan, agar mendapatkan kepercayaan dari masyarakat dalam penyelenggaraan pendidikan. Tujuannya menambah peran serta orang tua murid dan masyarakat dalam membantu peningkatan mutu pendidikan di sekolah, (6) pembentukan paguyupan kelas, strategi ini dilakukan untuk meningkatkan peran serta orang tua siswa terhadap pendidikan, (7) memberi sarapan pagi kepada siswa, strategi ini dilakukan untuk membiasakan anak agar mau belajar di rumah dan datang ke sekolah siap untuk belajar, (8) mengadakan studi banding, strategi ini dilakukan dengan harapan agar guru mampu ikut dalam pelaksanaan manajemen di sekolah. Berdasarkan hasil penelitian direkomendasikan saran-saran sebagai berikut: (1) bagi guru perluasan dan pengembangan peran guru dalam manajemen peningkatan mutu pendidikan di sekolah diharapkan selalu dikembangkan, (2) bagi kepala sekolah diharapkan memberi peluang kepada guru untuk memainkan perannya dan berpartisipasi aktif dalam manajemen peningkatan mutu pendidikan, kepala sekolah harus dapat menciptakan transparansi dan akuntabilitas serta selektif dalam melakukan pembagian tugas, (3) bagi pengawas, pengawas diharapkan dapat memberikan bantuan kepada guru yang belum memainkan perannya secara maksimal, pengawas juga diharapkan dapat membantu kepala sekolah, agar dapat melibatkan guru secara maksimal dalam manajemen peningkatan mutu pendidikan, (4) bagi Dinas Pendidikan Kabupaten dan Kota diharapkan dapat memberikan pelatihan secara terencana dan berkesinambungan kepada pengawas, kepala sekolah dan guru sehingga peran pengawas dan peran kepala sekolah, akan lebih optimal sehingga dapat meningkatkan peran guru dalam peningkatan mutu pendidikan, (5) bagi pemerintah diharapkan dalam membuat dan mengambil kebijakan yang tepat tentang guru, sehingga dapat memberikan pengaruh yang positif dan dapat memainkan perannya secara maksimal, (6) bagi Ilmu Manajemen Pendidikan temuan penelitian ini menjelaskan bahwa, peran guru dalam manajemen peningkatan mutu pendidikan di sekolah sangat memberikan kontribusi dan pengaruh yang cukup besar terhadap peningkatan mutu pendidikan, (7) bagi peneliti berikutnya penelitian ini membutuhkan penelitian lebih lanjut, diharapkan dengan penelitian yang berkaitan dengan topik, terbuka peluang untuk mengembangkan dan mengkaji lebih mendalam tentang peran guru dalam manajemen peningkatan mutu pendidikan baik dengan pendekatan yang sama maupun dengan pendekatan yang berbeda.

Pengaruh roa dan roe terhadap return saham pada perusahaan besar dan kecil di perusahaan manufaktur yang listing di BEI pada tahun 2009 / Gunawan Prasetio Adi

 

Kata kunci: ROA, ROE, Return Saham Dalam berinvestasi, investor tidak bisa dengan mudah menentukan saham yang akan dipilihnya. Hal ini harus dilakukan dengan beberapa pertimbangan yang antara lain dengan menganalisis laporan keuangan pada perusahaan yang sudah go public di Bursa Efek Indonesia. Kinerja perusahaan tercermin dari laporan keuangan yang di dalamnya dapat diketahui besaran arus kas, profitabilitas, dan tingkat risiko yang dihadapi perusahaan. Data-data laporan keuangan tersebut bisa mempengaruhi nilai perusahaan. Jadi profitabilitas mempengaruhi tingkat harga saham perusahaan yang bisa dinilai dari nilai perusahaan yang awalnya melakukan keputusan keuangan. Penelitian ini dilakukan dengan tujuan untuk menguji pengaruh ROA dan ROE terhadap return saham pada perusahaan besar dan kecil di perusahaan manufaktur yang listing di BEI pada tahun 2009. Data yang diambil adalah laporan keuangan tahun 2009, berupa neraca dan laporan laba rugi. Sampel yang digunakan adalah 60 perusahaan manufaktur dan dibagi menjadi dua golongan, yaitu ukuran besar dan ukuran kecil sehingga masing-masing golongan terdiri dari 30 perusahaan sampel. Ada tiga variabel yang digunakan yaitu: return saham sebagai dependent variable, sedangkan ROA dan ROE sebagai independent variable. Analisis yang digunakan adalah analisis regresi linier berganda. Teknik sampling dalam penelitian ini menggunakan purposive sampling. Hasil penelitian menunjukkan bahwa secara parsial dan simultan variabel ROA dan ROE tidak memiliki pengaruh yang signifikan terhadap return saham pada perusahaan manufaktur ukuran besar. Demikian juga perusahaan manufaktur ukuran kecil secara parsial dan simultan juga tidak memiliki pengaruh yang signifikan terhadap return saham. Berdasarkan hasil penelitian ini, dapat disarankan agar dilakukan penelitian lebih lanjut dengan menambah faktor fundamental lain sehingga diperoleh hasil yang signifikan.

Penerapan metode belajar learning cycle-5E pada mata pelajaran akuntansi terhadap siswa kelas XII IPS 1 untuk meningkatkan aktivitas dan hasil belajar di SMA Negeri 6 Malang / Dyah Titin Kurniatin

 

Kata Kunci: learning cycle-5 fase, aktivitas, hasil belajar. Berdasarkan hasil observasi awal dan wawancara dengan siswa maupun guru yang bersangkutan, mengindikasikan bahwa guru langsung pemberian tugas-tugas. Selanjutnya guru tidak memberikan eksplanasi dan evaluasi terhadap tugas yang diberikan. Dalam hal ini siswa belajar sendiri sehingga mereka belum menemukan jawaban mana yang benar yang harus dipergunakan. Tujuan penelitian adalah: (1) Untuk mendeskripsikan bagaimana meningkatkan aktivitas belajar siswa kelas XII-IPS1 dengan model Pembelajaran Learning cycle 5E di SMA Negeri 6 Malang. (2)Untuk mendeskripsikan bagaimana meningkatkan hasil belajar siswa kelas XII-IPS1 dengan menggunakan model Pembelajaran Learning Cycle 5E di SMA Negeri 6 Malang. Jenis penelitian yang digunakan adalah penelitian tindakan kelas (classroom action research) dengan pendekatan kualitatif. Alat pengumpulan data menggunakan, tes, lembar observasi, lembar catatan lapangan, dan pedoman wawancara. Sumber data yang digunakan dalam penelitian ini adalah siswa kelas XII-IPS1 SMA Negeri 6 Malang tahun ajaran 2009/2010. Hasil penelitian menunjukkan: model pembelajaran Learning Cycle 5E dapat meningkatkan aktivitas dan hasil belajar siswa. Pada siklus I berdasarkan lembar observasi aktivitas siswa dalam penerapan model pembelajaran learning cycle 5E memperoleh skor kurang dari kriteria ketuntasan belajar yaitu mendapat skor 56,66%. Pada siklus II nilai aktivitas siswa penilaian dengan lembar observasi aktivitas siswa skor rata-rata kelas meningkat menjadi 76,66% berarti dalam hal ini meningkat sebesar 20%. Peningkatan skor ini mengalami kenaikan secara signifikan. Hasil belajar yang diperoleh dari tiga aspek yaitu aspek kognitif siklus I sebesar 73,8% dan siklus II naik menjadi 77,1%. Sedangkan ditinjau dari segi afektif dapat diketahui persentase sebesar 56,7% dan untuk siklus II dengan persentase (65,8%). Untuk aspek psikomotorik pada siklus I hasil yang diperoleh sebesar 24,3% dan pada siklus II meningkat menjadi 65,8%. Dengan demikian penelitian ini dapat disimpulkan bahwa penerapan metode pembelajaran learning cycle 5E dapat meningkatkan aktivitas dan hasil belajar siswa kelas XII-IPS1 SMA Negeri 6 Malang. Beberapa saran dari peneliti diharapakan bisa meningkatkan aktivitas siswa dalam belajar untuk belajar secara mandiri seperti pada fase eksplorasi dan siswa tetap dapat mengingat dari kegiatan tersebut dikarenakan hasil dari menemukan dan mengetahui letak kesalahan diharapakan dari proses itu siswa tetap dapat mengingat materi yang telah dipelajari. Serta dapat dijadikan sebagai bahan dalam mengembangkan variasi-variasi metode untuk meminimalisasikan kejenuhan dalam proses belajar mengajar di dalam kelas

Pengembangan modul keterkaitan struktur, fungsi, dan proses serta kelainan/penyakit pada sistem saraf untuk mencapai SKL-SP dan tujuan mata pelajaran biologi pada siswa kelas XI di SMA Negeri I Grati Pasuruan / Dia Faroka

 

Kata kunci : Modul keterkaitan struktur, fungsi dan proses serta kelainan/penyakit pada sistem saraf, SKL-SP, Tujuan Mata Pelajaran Biologi. Berdasarkan hasil Observasi, diketahui bahwa pembelajaran Biolodi di SMA Negeri I Grati menggunakan Lesson Study dan Non Lesson Study. Proses Lesson Study dilaksanakan sekali setiap semester untuk mata pelajaran biologi begitu juga dengan mata pelajaran yang lain. Sehingga pelaksanaan lesson study belum dapat mencapai visi dan misi sekolah. Permasalahan yang terjadi pada Lesson Study maupun Non Lesson Study yaitu, a) Siswa kurang dilibatkan secara aktif dikelas, b) Kemampuan berfikir belum dipertimbangkan sebagai bagian integral dari pembelajaran, c) Siswa yang cerdas dan cepat belajarnya terhambat dengan adanya siswa yang lamban dan siswa yang lamban akan semakin kesulitan, LKS yang digunakan kurang efektif, efisien dan fleksibel, d) LKS belum dapat mencapai tujuan Biologi dan SKL-SP. Alternatif solusi permasalahan yang tejadi adalah a) menggunakan Bahan ajar berupa modul yang menerapkan informasi, dan pengetahuan, secara logis, kritis, kreatif dan inovatif. Sehingga siswa dapat membangun pengetahuannya sendiri dan tidak hanya menerima informasi saja, b) menggunakan Bahan ajar yaitu modul karena bersifat Self intructional, Self Containned, Adaptif, Stand alone,dan user friendly. Model Pengembangan modul yang digunakan penulis mengikuti langkahlangkah sebagai berikut : 1)Potensi dan Masalah, 2) Pengumpulan Informasi, 3) Desain Modul, 4) Validasi Modul pembelajaran dan uji coba kelompok kecil, 5) Revisi Modul pembelajaran I, 6) Uji Coba langsung Modul pembelajaran, 7) Revisi Modul pembelajaran II, 8) Penyempurnaan Modul. Hasil validasi yang dilakukan oleh ahli media, ahli materi, guru dalam tampilan modul yaitu SKL-SP dan Tujuan Biologi adalah 80,21%, 91,73%, 90,73%, sedangkan hasil validasi modul berdasarkan gagasan modul berupa visual,gambar dan video yaitu 79.58%, 96,87%, 93,75%.Hasil uji coba kelompok kecil dan besar yaitu 84.64% dan 89.58%. Data hasil validasi dari ahli media, ahli materi dan guru serta uji coba kelompok kecil dan besar bahwa modul tidak perlu direvisi. Meskipun berdasarkan data kuantitatif modul telah telah dinyatakan valid dan layak tetapi perlu ditindak lanjuti mengenai komentar dan saran ahli media, ahli materi, guru dan kelompok kecil serta besar. Produk yang dihasilkan adalah modul Keterkaitan Struktur, Fungsi, Dan Proses Serta Kelainan/Penyakit Pada Sistem Saraf untuk mencapai Kompetensi Dasar. “Keterkaitan antara Struktur, Fungsi, dan Proses Serta Kelainan/Penyakit yang terjadi pada Sistem Regulasi”. Modul ini mempunyai 5 kegiatan belajar dengan alokasi waktu 8 x 45 menit. Saran pemanfaatan dan pengembangan lebih lanjut dari hasil pengembangan ini dapat dikembangkan sebagai berikut 1) Modul yang dikembangkan dapat dimanfaatkan lebih lanjut dengan diproduksi oleh sekolah yang bersangkutan dengan seijin peniliti. Hal ini bertujuan untuk memenuhi kebutuhan sekolah dan membelajarkan siswa secara mandiri dan sebagai contoh modul yang memiliki komponen lengkap, memenuhi standart lulusan mata pelajaran dan tujuan mata pelajaran Biologi, 2) Diperlukan ketelitian dalam membuat modul yang mencapai SKL-SP dan Tujuan mata pelajaran Biologi

Penerapan pembelajaran model siklus belajar (the 5E learning cycle model) untuk meningkatkan keterampilan proses ilmiah dan motivasi belajar IPA siswa kelas VII-C SMPN 1 Sukodono Lumajang / Mas'udah

 

Jurusan IPA Terpadu, Program Pasca Sarjana Universitas Negeri Malang. Pembimbing: (I) Dr. Arif Hidayat, M.Si, (II) Dra. Endang Purwaningsih, M.Si. Kata kunci: Siklus belajar, Keterampilan proses, Motivasimbelajar. Kemampuan akademik siswa di kelas pada umumnya heterogen. Kondisi seperti ini merupakan suatu kesulitan tersendiri bagi seorang guru, terutama dalam pengelolaan kelas. Oleh karena itu, guru dituntut untuk mampu mengatasi hal tersebut melalui penerapan suatu metode dengan tepat. Kegiatan pembelajaran kini harus mengedepankan pembelajaran yang berpusat pada penyesuaian guru terhadap kebutuhan siswa, sehingga siswa dapat lebih aktif, kreatif dan merasa senang dalam lingkungan belajarnya. Hasil observasi dan wawancara dengan guru bidang studi serta melakukan pengamatan langsung pembelajaran di kelas pada SMPN 1 Sukodono khususnya kelas VII-C pada pembelajaran IPA ditemukan beberapa permasalahan di antaranya adalah: 1) siswa kurang aktif dalam kegiatan belajar; 2) pada saat guru sudah menerangkan hampir 50% siswa masih belum siap dengan pembelajaran, 3) aktivitas siswa dalam kegiatan pembelajaran masih rendah, pada saat guru memberikan pertanyaan kurang dari 30% siswa yang mengacungkan tangan, , 4) selama proses diskusi kelompok hanya mengandalkan teman yang dianggap pandai atau paling mampu dalam kelompok tersebut, 5) kegiatan pembelajaran masih didominasi guru dan siswa kurang diberi kesempatan untuk mengemukakan pendapat dalam proses pembelajaran.6) rata-rata kriteria keterampilan proses yang dimiliki siswa dalam belajar kurang baik (KB) dengan persentase antara 25-49%, sehingga siswa cenderung sulit untuk menyelesaikan permasalahan sendiri; 7) Hasil belajar siswa, ketuntasan secara klasikal baru mencapai 75,86%, sehingga kelas dinyatakan belum mencapai kriteria ketuntasan minimal (KKM). Untuk mengatasi adanya masalah dalam kegiatan belajar mengajar di kelas tersebut, perlu adanya perbaikan model pembelajaran. Salah satu inovasi pembelajaran yang di dalamnya terdapat serangkaian aktivitas untuk memperoleh pengetahuan selama proses pembelajaran adalah dengan menerapkan The 5 E Learning Cycle Model (LCM) Dalam the 5 E LCM, setiap fase siswa diberi kesempatan untuk berlatih mengoperasikan alat, berlatih menghitung dan menganalisis data, mengaplikasikan konsep fisika dikehidupan sehari-hari, mengambil kesimpulan dari materi yang disampaikan. Penelitian ini merupakan penelitian tindakan kelas (PTK) yang dilaksanakan dalam dua siklus, dan masing-masing siklus terdiri dari tiga kali pertemuan. Pengumpulan data dilaksanakan mulai tanggal 22 April sampai 3 Juli 2010. Subjek yang diteliti adalah siswa kelas VII-C SMP N 1 Sukodono yang berjumlah 29siswa, yang datanya dapat dianalisis dan disimpulkan yang terdiri dari 16 siswa perempuan dan 13 siswa laki-laki. Hasil penelitian menunjukkan bahwa penerapan pembelajaran model siklus belajar (learning cycle) dapat meningkatkan keterampilan proses ilmiah dan prestasi belajar IPA siswa di kelas VII-C SMPN 1 Sukodono. Peningkatan keterampilan proses ilmiah siswa didasarkan pada penguasaaan aspek Ketrampilan Proses Siswa. Hasil penelitian menunjukkan motivasi belajar siswa meningkat dari siklus I ke siklus II. Hasil penjaringan data dengan angket menunjukkan ada peningkatan motivasi sebesar 4% dari 84% pada siklus I menjadi 88% pada siklus II. Hasil observasi menunjukkan motivasi belajar siswa juga meningkat dari siklus I ke siklus II sebesar 6,5%. Hasil belajar Hasil belajar IPA siswa klasikal siswa berupa tes kognitif meningkat sebesar 12% dari siklus I ke siklus II yaitu dari siklus I sebesar 75,86% ke siklus II sebesar 86,20%. Peningkatan tersebut sudah memenuhi ketuntasan yang ditetapkan yaitu 85%. Saran dalam penelitian ini (1)Hasil dari penerapan pembelajaran model siklus belajar (learning cycle) terbukti telah berhasil meningkatkan keterampilan proses ilmiah dan prestasi belajar siswa, oleh karena itu bagi guru bidang studi disarankan untuk menerapkan model pembelajaran ini pada materi dengan karakteristik yang sesuai. (2) Bagi tenaga pengajar yang tertarik menggunakan model pembelajaran Learning Cycle -baiknya mempertimbangkan hal-hal seperti: kesiapan guru, kesiapan siswa, dan keter-sediaan waktu untuk menyusun bahan pembelajaran.(3) Guru diharapkan melakukan upaya pendekatan untuk lebih memotivasi siswa yang sering membuat ramai dan gaduh sehingga pelaksanaan kegiatan pembe-lajaran dapat berjalan lancar dan dapat meningkatkan hasil belajar siswa.(4) Guru hendaknya dapat melakukan pendekatan secara khusus pada siswa yang bermasalah untuk lebih meningkatkan motivasi belajarnya.

1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 | 34 | 35 | 36 | 37 | 38 | 39 | 40 | 41 | 42 | 43 | 44 | 45 | 46 | 47 | 48 | 49 | 50 | 51 | 52 | 53 | 54 | 55 | 56 | 57 | 58 | 59 | 60 | 61 | 62 | 63 | 64 | 65 | 66 | 67 | 68 | 69 | 70 | 71 | 72 | 73 | 74 | 75 | 76 | 77 | 78 | 79 | 80 | 81 | 82 | 83 | 84 | 85 | 86 | 87 | 88 | 89 | 90 | 91 | 92 | 93 | 94 | 95 | 96 | 97 | 98 | 99 | 100 | 101 | 102 | 103 | 104 | 105 | 106 | 107 | 108 | 109 | 110 | 111 | 112 | 113 | 114 | 115 | 116 | 117 | 118 | 119 | 120 | 121 | 122 | 123 | 124 | 125 | 126 | 127 | 128 | 129 | 130 | 131 | 132 | 133 | 134 | 135 | 136 | 137 | 138 | 139 | 140 | 141 | 142 | 143 | 144 | 145 | 146 | 147 | 148 | 149 | 150 | 151 | 152 | 153 | 154 | 155 | 156 | 157 | 158 | 159 | 160 | 161 | 162 | 163 | 164 | 165 | 166 | 167 | 168 | 169 | 170 | 171 | 172 | 173 | 174 | 175 | 176 | 177 | 178 | 179 | 180 | 181 | 182 | 183 | 184 | 185 | 186 | 187 | 188 | 189 | 190 | 191 | 192 | 193 | 194 | 195 | 196 | 197 | 198 | 199 | 200 | 201 | 202 | 203 | 204 | 205 | 206 | 207 | 208 | 209 | 210 | 211 | 212 | 213 | 214 | 215 | 216 | 217 | 218 | 219 | 220 | 221 | 222 | 223 | 224 | 225 | 226 | 227 | 228 | 229 | 230 | 231 | 232 | 233 | 234 | 235 | 236 | 237 | 238 | 239 | 240 | 241 | 242 | 243 | 244 | 245 | 246 | 247 | 248 | 249 | 250 | 251 | 252 | 253 | 254 | 255 | 256 | 257 | 258 | 259 | 260 | 261 | 262 | 263 | 264 | 265 | 266 | 267 | 268 | 269 | 270 | 271 | 272 | 273 | 274 | 275 | 276 | 277 | 278 | 279 | 280 | 281 | 282 | 283 | 284 | 285 | 286 | 287 | 288 | 289 | 290 | 291 | 292 | 293 | 294 | 295 | 296 | 297 | 298 | 299 | 300 | 301 | 302 | 303 | 304 | 305 | 306 | 307 | 308 | 309 | 310 | 311 | 312 | 313 | 314 | 315 | 316 | 317 | 318 | 319 | 320 | 321 | 322 | 323 | 324 | 325 | 326 | 327 | 328 | 329 | 330 | 331 | 332 | 333 | 334 | 335 | 336 | 337 | 338 | 339 | 340 | 341 | 342 | 343 | 344 | 345 | 346 | 347 | 348 | 349 | 350 | 351 | 352 | 353 | 354 | 355 | 356 | 357 | 358 | 359 | 360 | 361 | 362 | 363 | 364 | 365 | 366 | 367 | 368 | 369 | 370 | 371 | 372 | 373 | 374 | 375 | 376 | 377 | 378 | 379 | 380 | 381 | 382 | 383 | 384 | 385 | 386 | 387 | 388 | 389 | 390 | 391 | 392 | 393 | 394 | 395 | 396 | 397 | 398 | 399 | 400 | 401 | 402 | 403 | 404 | 405 | 406 | 407 | 408 | 409 | 410 | 411 | 412 | 413 | 414 | 415 | 416 | 417 | 418 | 419 | 420 | 421 | 422 | 423 | 424 | 425 | 426 | 427 | 428 | 429 | 430 | 431 | 432 | 433 | 434 | 435 | 436 | 437 | 438 | 439 | 440 | 441 | 442 | 443 | 444 | 445 | 446 | 447 | 448 | 449 | 450 | 451 | 452 | 453 | 454 | 455 | 456 | 457 | 458 | 459 | 460 | 461 | 462 | 463 | 464 | 465 | 466 | 467 | 468 | 469 | 470 | 471 | 472 | 473 | 474 | 475 | 476 | 477 | 478 | 479 | 480 | 481 | 482 | 483 | 484 | 485 | 486 | 487 | 488 | 489 | 490 | 491 | 492 | 493 | 494 | 495 | 496 | 497 | 498 | 499 | 500 | 501 | 502 | 503 | 504 | 505 | 506 | 507 | 508 | 509 | 510 | 511 | 512 | 513 | 514 | 515 | 516 | 517 | 518 | 519 | 520 | 521 | 522 | 523 | 524 | 525 | 526 | 527 | 528 | 529 | 530 | 531 | 532 | 533 | 534 | 535 | 536 | 537 | 538 | 539 | 540 | 541 | 542 | 543 | 544 | 545 | 546 | 547 | 548 | 549 | 550 | 551 | 552 | 553 | 554 | 555 | 556 | 557 | 558 | 559 | 560 | 561 | 562 | 563 | 564 | 565 | 566 | 567 | 568 | 569 | 570 | 571 | 572 | 573 | 574 | 575 | 576 | 577 | 578 | 579 | 580 | 581 | 582 | 583 | 584 | 585 | 586 | 587 | 588 | 589 | 590 | 591 | 592 | 593 | 594 | 595 | 596 | 597 | 598 | 599 | 600 | 601 | 602 | 603 | 604 | 605 | 606 | 607 | 608 | 609 | 610 | 611 | 612 | 613 | 614 | 615 | 616 | 617 | 618 | 619 | 620 | 621 | 622 | 623 | 624 | 625 | 626 | 627 | 628 | 629 | 630 | 631 | 632 | 633 | 634 | 635 | 636 | 637 | 638 | 639 | 640 | 641 | 642 | 643 | 644 | 645 | 646 | 647 | 648 | 649 | 650 | 651 | 652 | 653 |